View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_62 (Length: 325)
Name: NF3710_low_62
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_62 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 100 - 319
Target Start/End: Original strand, 15506887 - 15507106
Alignment:
| Q |
100 |
caaaatgataagccccttgaagagtactttatgggaggcacattcaatacttgaaatgctctagtattgcagccttaaatctccactagtattaattgga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
15506887 |
caaaatgataagccccttgaagagtactttatgggaggcacattcaatacttgaaatgctctagtgttgcagccttaaatctccaccagtattaattgga |
15506986 |
T |
|
| Q |
200 |
gattgagttgaccaaagatcatatgaaagacatgatggaaatccagcaaacaaagttcatttcttgcctctttcaggcatgtcttgttttgttcttattt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||| |||||||||||||||||||||||| |
|
|
| T |
15506987 |
gattgagttgaccaaagatcatatgaaagacatgatgggaatccagcaaacaaagttcatttcattcctctttcaagcatgtcttgttttgttcttattt |
15507086 |
T |
|
| Q |
300 |
ccacttgttagttcatctca |
319 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
15507087 |
ccacttgttagttcatctca |
15507106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 15506786 - 15506861
Alignment:
| Q |
1 |
atttagttgctctctctgacaataaagataagagtgctcacttcatagtacaaccctctcacacactgatataaca |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15506786 |
atttagttgctctctctgacaataaagataagagtgctcacttcatagtacaaccctctcacacactgatataaca |
15506861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University