View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_63 (Length: 320)
Name: NF3710_low_63
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_63 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 4e-44; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 172 - 270
Target Start/End: Complemental strand, 1331489 - 1331391
Alignment:
| Q |
172 |
gcgtagtatactcacatggattgttgaactacaaaaatgtcaattgttcgtctttctctaacggatcatgttcatgaaccaaataaagagtaaagttag |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1331489 |
gcgtagtatactcacatggattgttgaactacaaaaatgtcaattgttcatctttctctaacggatcatgttcatgaactaaataaagagtaaagttag |
1331391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 16 - 63
Target Start/End: Complemental strand, 1331702 - 1331655
Alignment:
| Q |
16 |
agtttccacttcaattcttcatctttgttttaacatatgatcgagttt |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1331702 |
agtttccacttcaattcttcatctttgttttaacatatgaacgagttt |
1331655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 58 - 92
Target Start/End: Complemental strand, 1331605 - 1331571
Alignment:
| Q |
58 |
gagtttgatacctagaaatgaaacatctaaattat |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1331605 |
gagtttgatacctagaaatgaaacatctaaattat |
1331571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University