View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_65 (Length: 316)
Name: NF3710_low_65
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_65 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 88 - 299
Target Start/End: Complemental strand, 8829860 - 8829649
Alignment:
| Q |
88 |
ttgaagtttgagttttgagtgaattacctgaatttggtcaccaatattgacaatgaaggtattaggaacagggttaatagttacccatttaccattctta |
187 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8829860 |
ttgaagtttgagttttgactgaattacctgaatttggtcaccaatattgacaatgaaggtattaggaacagggttaatagttacccatttaccatcctta |
8829761 |
T |
 |
| Q |
188 |
aggacttgcaaaccagccacatcattttgcaacaaaatggtaatgacatttgggtcagcatgtgctggcaaaccataagttaggtctggttcaggacatg |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8829760 |
aggacttgcaaaccagccacatcattttgcaacaaaatggtaatgacatttgggtcagcatgtgctggcaaaccataagttaggtctggttcaggacatg |
8829661 |
T |
 |
| Q |
288 |
gagggtagtagt |
299 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8829660 |
gagggtagtagt |
8829649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 63
Target Start/End: Complemental strand, 8829937 - 8829885
Alignment:
| Q |
12 |
atgaacattacagtttataggg-cagcgttcaaccaatatggtcacctatttt |
63 |
Q |
| |
|
|||||| |||||| |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
8829937 |
atgaacgttacagcttataggggcagcgttcaacgaatatggtcacctatttt |
8829885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University