View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_69 (Length: 303)
Name: NF3710_low_69
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_69 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 6 - 284
Target Start/End: Original strand, 4387538 - 4387816
Alignment:
| Q |
6 |
gactaatttggtaaaattgnnnnnnnctttcattataatttctcattagtttttataaatcaataacatgtgacactcatactaggatgtagagagtatc |
105 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4387538 |
gactaatttggtaaaattgtttttttctttcattataatttctcattagtttttataaatcaataacatgtgacactcatactaggatgtagagagtatc |
4387637 |
T |
 |
| Q |
106 |
aaaatttcgcccttaattttggaaccttatgcttttcaataggggtttattagtgtcaattttggatttaagtttataagtttataagcataagtttttt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4387638 |
aaaatttcgcccttaattttggaaccttatgctattcaataggggtttattagtgtcaattttggatttaagtttataagtttataagcataagtttttt |
4387737 |
T |
 |
| Q |
206 |
acttttactctttgaagggacacttaggagctctaccaaataaaaaccaaacatactaggtattagttgacgtatgtta |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4387738 |
acttttactctttgaagggacacttaggagctctaccaaataaaaaccaaacatactaggtattagttgacgtatgtta |
4387816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University