View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_73 (Length: 300)
Name: NF3710_low_73
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_73 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 21 - 271
Target Start/End: Original strand, 15527452 - 15527702
Alignment:
| Q |
21 |
atcaactggttagaatttattcaaataagcacctacctaagggagtaaaaaggcaaacgaaatgatattaaatccagcattacacaaccgaagaaaagaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||||| || ||||||| |
|
|
| T |
15527452 |
atcaactggttagaatttattcaaataagcatctacctaagggagtaaaaaggcaaaccgaatgaaattaaatccagcattacacaacggagaaaaagaa |
15527551 |
T |
 |
| Q |
121 |
atgttttcttagctgtttcnnnnnnnnnnnnnnnngatgttgtttcatctatctcaaaatgagtgatctagttaattgtttaaccgggcgccgcccctag |
220 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||||| |
|
|
| T |
15527552 |
atgttttcttagctgtttcaaaaaagaaagaaaaagatgttgtttcatctatctcaaaatgagtgatctagttaactgtttaaccaggtcgcgcccctag |
15527651 |
T |
 |
| Q |
221 |
caagcgcaaggtgagttaccgtgccggacctcgtaatatttggagcctcaa |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15527652 |
caagcgcaaggtgagttaccgtgccggacctcgtaatatttggagcctcaa |
15527702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 227 - 271
Target Start/End: Original strand, 18885948 - 18885992
Alignment:
| Q |
227 |
caaggtgagttaccgtgccggacctcgtaatatttggagcctcaa |
271 |
Q |
| |
|
||||||||||||| ||||||||||||| ||| || |||||||||| |
|
|
| T |
18885948 |
caaggtgagttacggtgccggacctcgcaatcttaggagcctcaa |
18885992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 47582425 - 47582373
Alignment:
| Q |
218 |
tagcaagcgcaaggtgagttaccgtgccggacctcgtaatatttggagcctca |
270 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| | ||| || ||||||||| |
|
|
| T |
47582425 |
tagcaagcgcaaggtgagctacggtgccggaccttgcaattttaggagcctca |
47582373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University