View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_77 (Length: 294)
Name: NF3710_low_77
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_77 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 32121213 - 32120930
Alignment:
| Q |
1 |
caggtataattcaaaggatggtcgatttttacatgcttcttctttgaaatgcttataaactgatccgcaacacgatttaactattttattaaactaaaag |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32121213 |
caggtataattcaaaggatggacgatttttacatgcttcttctttgcaatgcttataaactgatccgcaacacaatttaactattttattaaactaaaag |
32121114 |
T |
 |
| Q |
101 |
atttggaacatttgatcaggctgtagctgttaaaagacttgatacaactggtttccaaggtgagaaagaatttttagtggaggttctcatgctctctctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32121113 |
gtttggaacatttgatcaggctgtagctgttaaaagacttgatacaactggtttccaaggtgagaaagaatttttagtggaggttctcatgctctctctt |
32121014 |
T |
 |
| Q |
201 |
ctacaccatcccaaccttgttagtatgattggttactgcgcggaaggtgatcaacgacttcttgtctatgaatacatgcctatg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32121013 |
ctacaccatcccaaccttgttagtatgattggttactgcgcggaaggtgatcaacgacttcttgtctatgaatacatgcctatg |
32120930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University