View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_80 (Length: 291)
Name: NF3710_low_80
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_80 |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0088 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 18 - 282
Target Start/End: Original strand, 47374 - 47638
Alignment:
| Q |
18 |
atcatcgacatatttataacgataaagggtctcaaaatgaatcctatcnnnnnnnatatgggtgatttcatcgtaactaagcttcatgtaacctcccttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47374 |
atcatcgacatatttataacgataaagggtctcaaaatgaatcctatctttttttatatgggtgatttcatcgtaactaagcttcatgtaacctcccttc |
47473 |
T |
 |
| Q |
118 |
nnnnnnnnnnnnnnnnnngcttcatgtaacccgacaccataaaatgatcaaacactactttagttaggaaagagaacacataacttcagacagaaacaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47474 |
aaaaaaataaaaataaaagcttcatgtaacccgacaccataaaatgatcaaacactactttagttaggaaagaggacacataacttcagacagaaacaat |
47573 |
T |
 |
| Q |
218 |
atttttagaggactgaattagatcggctcttgtttaaatttgagtttgttaaatagcttgatgat |
282 |
Q |
| |
|
||||||| ||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47574 |
atttttaaaggactgtattagatcgactcttgtttaaatttgagtttgttaaatagcttgatgat |
47638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University