View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_82 (Length: 290)
Name: NF3710_low_82
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_82 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 11 - 175
Target Start/End: Original strand, 7962166 - 7962330
Alignment:
| Q |
11 |
gtatctcgttgtttgtgcatttttgaatgattttgcggtaaacattgaaatgcttatcatcggccgcctattgcttggggttggtgtaggatgtctgata |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7962166 |
gtatctcattgtttgtgcatttttgaatgattttgcggtaaacattgaaatgcttatcatcggccgcctattgcttggggttggtgtaggatgtctgata |
7962265 |
T |
|
| Q |
111 |
ccttgaaaatagtaagttgacattgcctcaacttcgtagggatatgctactttcaatatctttcc |
175 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7962266 |
ccttgaaaatagtaagttggcattgcctcaacttcgtagggatatgctactttcaatatctttcc |
7962330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 59 - 102
Target Start/End: Complemental strand, 35490826 - 35490783
Alignment:
| Q |
59 |
aatgcttatcatcggccgcctattgcttggggttggtgtaggat |
102 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
35490826 |
aatgcttatcatcggtcgcctattgcttggttttggtgtaggat |
35490783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University