View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_83 (Length: 284)
Name: NF3710_low_83
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_83 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 284
Target Start/End: Complemental strand, 46666809 - 46666537
Alignment:
| Q |
18 |
ttgcttatttctccattagcgacagttgaattgttgatgctcttaaaaagctctgctaatgcttcaacatcattgtgagagtctggaaaaccaaaaattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46666809 |
ttgcttatttctccattagcgacagttgaattgttgatgctcttaaaaagctctgctaatgcttcaacatcattgtgagagtctggaaaaccaaaaattt |
46666710 |
T |
|
| Q |
118 |
gtacgcaagtttatttaaactacaaaactgtctagcaaaaataactcacaatct--------tatatatatcatagaaatatacaagaattaattaaagc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46666709 |
gtacgcaagtttatttaaactacaaaactgtctagcaaaaataact--caatcttatatatatatatatatcatagaaatatacaagaattaattaaagc |
46666612 |
T |
|
| Q |
210 |
ttaattaacataatctaattggattaaccgatagacatacaagcagtctgtgatgcaagaattgccggatcctcc |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46666611 |
ttaattaacataatctaattggattaaccgatagacatacaagcagtctgtgatgcaagaattgccggatcctcc |
46666537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University