View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_92 (Length: 259)
Name: NF3710_low_92
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_92 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 328512 - 328756
Alignment:
| Q |
1 |
aaaatggtttgccaccccaaattgtaacggtggtttctattgnnnnnnnaatatcttccaactgcaattaattgatgctgcataaccgagtaatatttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
328512 |
aaaatggtttgccaccccaaattgtaacggtggtttctattgtttttttaatatcttccaactgcaattaattgatgctgcacaaccgagtaatatttga |
328611 |
T |
|
| Q |
101 |
tgacatttctataccatatttaggattttcatgctactacaatcaaataatttcattagtatttgagaaaaaatttctacaatatctcattgatgataac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
328612 |
tgacatttctataccatatttaggattttcatgctgctacaatcaaataatttcattagtatttgagaaaaaatttctacaatatctcattgatggtaac |
328711 |
T |
|
| Q |
201 |
tacaccaagggtttcaagttgtggaccacatcatgtgttgcgact |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
328712 |
tacaccaagggtttcaagttgtggaccacatcatgtgtcgcgact |
328756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University