View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_95 (Length: 254)
Name: NF3710_low_95
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_95 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 157 - 254
Target Start/End: Original strand, 19971886 - 19971985
Alignment:
| Q |
157 |
caataaactcaaaaattgcattgtagaagaatttttaagggatttattaaattttcaaaatttaatc--tgtgatcataatactcttaatattaaaaata |
254 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||||||||||||| |
|
|
| T |
19971886 |
caataaactcaaaaattgtattttagaagaatttttaagggatttattaaattttcaaaatttaatctatgcgattataatactcttaatattaaaaata |
19971985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 68 - 119
Target Start/End: Original strand, 19971799 - 19971850
Alignment:
| Q |
68 |
gggacgaagtggaaataacatgtaactttagaatggagttttgagatgttta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19971799 |
gggacgaagtggaaataacatgtaactttagaatggagttttgagatgttta |
19971850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 56
Target Start/End: Original strand, 19971745 - 19971784
Alignment:
| Q |
17 |
gaagggaggagaagggtctgaaaaaggtgtgctttgaaag |
56 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
19971745 |
gaagggaggggaagagtctgaaaaaggtgtgctttgaaag |
19971784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University