View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3710_low_96 (Length: 251)

Name: NF3710_low_96
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3710_low_96
NF3710_low_96
[»] chr2 (2 HSPs)
chr2 (1-154)||(1249922-1250093)
chr2 (199-235)||(1250138-1250174)


Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 1249922 - 1250093
Alignment:
1 ttggggttggaacccgggagattgtctcatgcgttagtgttact--ttttgcgcttaggaggttgaggctggggtatgctttggtttgctgcttcct--- 95  Q
    |||||| |||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||       
1249922 ttggggatggaacccgggagattgtctcatgcgttagtgttactgtttttgcgcttaggaggttgaggctggggtatgctttggtttgctgcttcctgct 1250021  T
96 -------------gctttttggtatatggcggcctcaatttcttgacagtagccgctaggaggttctgatta 154  Q
                 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
1250022 ttctggtatgctggctttttggtatatggcggcctcaatttcttgacagtagctgctaggaggttctgatta 1250093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 199 - 235
Target Start/End: Original strand, 1250138 - 1250174
Alignment:
199 acggcagaagggtttctggtatatgagtgccctatgt 235  Q
    |||||||||||||||||||||||||||| ||||||||    
1250138 acggcagaagggtttctggtatatgagtaccctatgt 1250174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University