View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_98 (Length: 250)
Name: NF3710_low_98
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_98 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 107 - 240
Target Start/End: Complemental strand, 10298811 - 10298678
Alignment:
| Q |
107 |
gtaaccggtctcccctcatacagttcagtgaagacagagagccgtagcatgtcttggaagcttatttatggtttttagctgtattctttgcaaagaag-- |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10298811 |
gtaaccggtctcccctcatacagttcagtgaagacagaa--ccgtagcatgtcttggaagcttatttatggtttttagctgtattctttgcaaagaagag |
10298714 |
T |
|
| Q |
205 |
agagtgaaaaaacttaaataaagttttatgtctctg |
240 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
10298713 |
agagtgaaaaaacttgaataaagttttatgcctctg |
10298678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 10298917 - 10298848
Alignment:
| Q |
1 |
tttaatgagaagaacaaaaatgtaccatcttgttagaaattgttggtggttatgtactatatgtattggc |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10298917 |
tttaatgagaagaacaaaaatgtaccatcttgttagaaattgttggtggttatgtactatatgtattggc |
10298848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University