View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3711_high_25 (Length: 211)
Name: NF3711_high_25
Description: NF3711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3711_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 33 - 201
Target Start/End: Original strand, 24401185 - 24401353
Alignment:
| Q |
33 |
gcataatttgcaggtggataagattgaggacagtattgagttcataagctctaggcctaagcctcttgccctctatgttttcaccaaaaacaaaacactg |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24401185 |
gcataatttgcaggtggataagattgaggacagtattgaattcataagctctaggcctaagcctcttgccctttatgttttcaccaaaaacaaaacactg |
24401284 |
T |
|
| Q |
133 |
cagaacagaatgatatctgaaacatcatcaggcagtgttactttcaatgatgcaattctgcaagtatta |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24401285 |
cagaacagaatgatatctgaaacatcatcaggcagtgttactttcaatgatgcaattctgcaagtatta |
24401353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 38 - 161
Target Start/End: Original strand, 41845585 - 41845708
Alignment:
| Q |
38 |
atttgcaggtggataagattgaggacagtattgagttcataagctctaggcctaagcctcttgccctctatgttttcaccaaaaacaaaacactgcagaa |
137 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||||||||| ||| | |||||| ||||| || | |||| ||||| || ||||| |||||||||| |
|
|
| T |
41845585 |
atttgcaggtggagaagattgaagacggtattgagttcataaactcaaagcctaaacctctagcaatttatgccttcacaaagaacaatacactgcagag |
41845684 |
T |
|
| Q |
138 |
cagaatgatatctgaaacatcatc |
161 |
Q |
| |
|
||| || |||||||||||||||| |
|
|
| T |
41845685 |
aagattggtatctgaaacatcatc |
41845708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University