View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3711_high_27 (Length: 203)
Name: NF3711_high_27
Description: NF3711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3711_high_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 40171906 - 40171716
Alignment:
| Q |
1 |
cctataccacttacccaaacatactgttagagatgaatattgcattggttaatttatggtaccaaacacaaacaagaaatt-gtaaacctataaaagcat |
99 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40171906 |
cctataccacttacccaaacatactcttagagatgaatattgcattggttaatttatggtaccaaacacaaacaagaaatttgtaaacctataaaagcat |
40171807 |
T |
|
| Q |
100 |
caaaatagatcaaaatgctactctgctagcaatcactttgacaattacaacaagtgactaaaacattaaaataaatgaagacgacaaacct |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40171806 |
caaaatagatcaaaatgctactctgctagcaatcactttgacaattacaacaagtgactaaaacattaaaataaatgaagacgacaaacct |
40171716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University