View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3711_low_28 (Length: 247)
Name: NF3711_low_28
Description: NF3711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3711_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 2129782 - 2129545
Alignment:
| Q |
1 |
tgaataaagtagtaaataaccattaaaatnnnnnnntaatctttggtgcatgaacatgagaagaagaaaaataggtaaatggctaccttgttttgaatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
2129782 |
tgaataaagtagtaaataaccattaaaataaaaaattaatctttggtgcatgaacatgagaagaagaaaaataggtaaatggctacctggttt-gaatct |
2129684 |
T |
|
| Q |
101 |
gatagtgatgagaaatcaaacaaagtagattgatctctttaggtttacaatcaaaactagttgaatttgaaagcaaaggtggaatttgatgagcaagtat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
2129683 |
gatagtgatgagaaatcaaacaaagtagattgatctctttaggtttacaatcaaaactagttgaatttgaaagcaaaagcggaatttgatgagcaagtat |
2129584 |
T |
|
| Q |
201 |
ccaacaatgtgttc-acacaatgcaattcaatgatgatg |
238 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2129583 |
ccaacaatgtgttcgacacaatgcaattcaatgatgatg |
2129545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 94 - 145
Target Start/End: Complemental strand, 2119059 - 2119008
Alignment:
| Q |
94 |
tgaatctgatagtgatgagaaatcaaacaaagtagattgatctctttaggtt |
145 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
2119059 |
tgaatccgatagtgttgagaaatcaaacaaggtagatagatctctttaggtt |
2119008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University