View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3711_low_35 (Length: 204)
Name: NF3711_low_35
Description: NF3711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3711_low_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 113 - 187
Target Start/End: Original strand, 2421641 - 2421715
Alignment:
| Q |
113 |
agatgaagatggttctgttttatctcacccaatatgagtgtctcatctatttaatattggacatctaaagtataa |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2421641 |
agatgaagatggttctgttttatctcacccaatatgagtgtctcatctatttaatattggacatctaaagtataa |
2421715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University