View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3712_high_11 (Length: 256)
Name: NF3712_high_11
Description: NF3712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3712_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 126 - 253
Target Start/End: Original strand, 33471828 - 33471955
Alignment:
| Q |
126 |
gagcgaagctctcccacaataaatcaatatatggcgatgggaacatctttgaagccacaatcaagtagcatgaaataactctgaaatatcataaaaatta |
225 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
33471828 |
gagcgaagctctcccacagtaaatcaatatatggcgatgggaacatcttcgaagcaacaatcaagtagcatgaaataactgtgaaatatcttaaaaatta |
33471927 |
T |
 |
| Q |
226 |
aaagactattactttttccaccctatgc |
253 |
Q |
| |
|
||||||||||||||||| |||||||||| |
|
|
| T |
33471928 |
aaagactattacttttttcaccctatgc |
33471955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 148
Target Start/End: Complemental strand, 27702001 - 27701946
Alignment:
| Q |
92 |
aaaaattgccaagcaaagacaactactttttatggagcgaagctctcccacaataaa |
148 |
Q |
| |
|
|||| |||||||||||| |||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
27702001 |
aaaagttgccaagcaaacacaattt-tttttatggcgcgaagctctcccacaataaa |
27701946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University