View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3712_high_12 (Length: 252)
Name: NF3712_high_12
Description: NF3712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3712_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 22 - 239
Target Start/End: Complemental strand, 31860920 - 31860703
Alignment:
| Q |
22 |
ttgaaaatatacatgttgnnnnnnntctcacattgtttagaattaattgtaaagaaaggggagaccaaactatatatgagttatagtttttgcttgcaaa |
121 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31860920 |
ttgaaaatatacatgttgaaaaaaatctcacattgtttagaattaattgtaaagaaaggggagaccaaactatatatgagttatagtttttgcttgcaaa |
31860821 |
T |
 |
| Q |
122 |
atgtactggttgaaaacactcttgcatttaaccnnnnnnnnnnnnnnnccttgtcttatactcttgtcttagaatgttttaagatgtatttaatatttcc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31860820 |
atgtactggttgaaaacactcttgcatttaaactttttttttttttttccttgtcttatactcttgtcttagaatgttttaagatgtatttaatatttcc |
31860721 |
T |
 |
| Q |
222 |
tttggagggtgatgatgt |
239 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
31860720 |
tttggagggtgttgatgt |
31860703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University