View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3712_low_13 (Length: 256)

Name: NF3712_low_13
Description: NF3712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3712_low_13
NF3712_low_13
[»] chr8 (1 HSPs)
chr8 (126-253)||(33471828-33471955)
[»] chr3 (1 HSPs)
chr3 (92-148)||(27701946-27702001)


Alignment Details
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 126 - 253
Target Start/End: Original strand, 33471828 - 33471955
Alignment:
126 gagcgaagctctcccacaataaatcaatatatggcgatgggaacatctttgaagccacaatcaagtagcatgaaataactctgaaatatcataaaaatta 225  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||| |||||||||    
33471828 gagcgaagctctcccacagtaaatcaatatatggcgatgggaacatcttcgaagcaacaatcaagtagcatgaaataactgtgaaatatcttaaaaatta 33471927  T
226 aaagactattactttttccaccctatgc 253  Q
    ||||||||||||||||| ||||||||||    
33471928 aaagactattacttttttcaccctatgc 33471955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 148
Target Start/End: Complemental strand, 27702001 - 27701946
Alignment:
92 aaaaattgccaagcaaagacaactactttttatggagcgaagctctcccacaataaa 148  Q
    |||| |||||||||||| |||| |  ||||||||| |||||||||||||||||||||    
27702001 aaaagttgccaagcaaacacaattt-tttttatggcgcgaagctctcccacaataaa 27701946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University