View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3713_low_15 (Length: 217)

Name: NF3713_low_15
Description: NF3713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3713_low_15
NF3713_low_15
[»] chr5 (1 HSPs)
chr5 (11-199)||(9791450-9791638)


Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 11 - 199
Target Start/End: Complemental strand, 9791638 - 9791450
Alignment:
11 gattatacttttgggattttgatgaagggactttgtttaacgaataggattggtgaaggttttaagcttttgcagcttattaagaataacggggttacac 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9791638 gattatacttttgggattttgatgaagggactttgtttaacgaataggattggtgaaggttttaagcttttgcagcttattaagaataacggggttacac 9791539  T
111 ccaatactgttatttataatactttgcttcatgcactttgtaggaatggaaaaattggtagggctaggagcttgatgaatgagatggtg 199  Q
    | |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
9791538 caaatactgttatttacaatactttgcttcatgcactttgtaggaatggaaaagttggtagggctaggagcttgatgaatgagatggtg 9791450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University