View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3713_low_7 (Length: 309)
Name: NF3713_low_7
Description: NF3713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3713_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 11 - 277
Target Start/End: Complemental strand, 14735325 - 14735060
Alignment:
| Q |
11 |
catagggttgtggagataatcacgtctacacaaaacttagaaaaccacgttgtctcacaccgaactcttttctaaccggctgacattttttgtttatact |
110 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14735325 |
catagagttgtggagataatcacatctacacaaaacttagaaaaccacgttg-ctcacaccgaactcttttctaaccggctgacattttttgtttatact |
14735227 |
T |
 |
| Q |
111 |
taaagtcagtgaactaagaaaatcaaagaccataccagtggtgattccaattttactcgagtcccatcattttgaacctggtgcttcaagaatttcttgc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
14735226 |
taaagtcagtgaactaagaaaatcaaagaccataccagtggtgattccagttttactcgagtcccatcattttgaacctggtgcttcaagaatttcttac |
14735127 |
T |
 |
| Q |
211 |
tcatctctcaatacttctcactagaaatggctaagcgcttgactaaccgctacttatcctatctcat |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
14735126 |
tcatctctcaatacttctcactagaaatggctaaccgcttgactaacggctacttatcctatctcat |
14735060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University