View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3713_low_8 (Length: 308)
Name: NF3713_low_8
Description: NF3713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3713_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 10 - 290
Target Start/End: Original strand, 2745400 - 2745680
Alignment:
| Q |
10 |
attattctctgttgtcttcagtcaaatggcatcactctttgtggaacaaggtgctgcaatggagactaaaatttccacttttcacatccctcctgcaagt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2745400 |
attattctctgttgtcttcagtcaaatggcatcactctttgtggaacaaggtgctgcaatggagactaaaatttccacttttcacatccctcctgcaagt |
2745499 |
T |
|
| Q |
110 |
atgtcaagctttgacattctcagtgtagtttctttcatcttcatctatcggagaattctcgaccctcttgttgctagatttacaaagaaatccaaaggta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2745500 |
atgtcaagctttgacattctcagtgtagtttccttcatcttcatctatcggagaattctcgaccctcttgttgctagatttacaaagaaatccaaaggta |
2745599 |
T |
|
| Q |
210 |
tcaccgagcttcaaaggatgggaataggtctagtattagcaatcatagcaatggtttcagcaggattagtagagattttcc |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2745600 |
tcaccgagcttcaaaggatgggaataggtctagtattagcaatcatagcaatggtttcagcaggattagtagagattttcc |
2745680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University