View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3714_high_2 (Length: 337)
Name: NF3714_high_2
Description: NF3714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3714_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 51771269 - 51770948
Alignment:
| Q |
1 |
gttgaaaatggcctttcaccggccttccccaaaacttgctcaatgcctgcaaatactattactgtctctataccctaaccaatcgattttcccattttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51771269 |
gttgaaaatggcctttcaccggccttccccaaaacttgctcaatgcctgcaaatactattactgtctctataccctaaccaatccattttcccattttag |
51771170 |
T |
|
| Q |
101 |
aaaacaacactctttctctctcaagtagtaacatcaagaaagggagagtg----agtgagagaagcaattagcagcaataacatcattatcgactgaaag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51771169 |
aaaacaacactctttctctctcaagtagtaacatcaagaaagggagagtgtgtgagtgagagaagcaattagcagcaataacatcattatcgactgaaag |
51771070 |
T |
|
| Q |
197 |
acaagaagaaggcttggcttgactatcatcattttcattctgttttacagccaccagcaatggatgtgtttgtggtggacacggtggcggtggttgtttc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51771069 |
acaagaagaaggcttggcttgactatcatcattttcattctgttttacagctaccagcaatggatgtgtttgtggtggacacggtggcggtggttgtttc |
51770970 |
T |
|
| Q |
297 |
atcttcttccacagtagtagta |
318 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
51770969 |
atcttcttccacagtagtagta |
51770948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University