View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3714_low_8 (Length: 214)
Name: NF3714_low_8
Description: NF3714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3714_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 33099878 - 33100049
Alignment:
| Q |
1 |
ttatgtttatagaactacttttaatataatatgaatggaatcgattattgatattagcaaatatatgtgtatacacatagattcactttttggagaaagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||| |
|
|
| T |
33099878 |
ttatgtttatagaactacttttaatataatatgaatggaatcgattattgatattagcaaataaatgtatatacacatagattcacttttttgagaaagt |
33099977 |
T |
|
| Q |
101 |
aaagtgatttggaattctaaaattaattttgatc-attatttaacatctttagggttcttgaatagaattat |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33099978 |
aaagtgatttggaattctaaaattaatttttatcaattatttaacatctttagggttcttgaatagaattat |
33100049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University