View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3716_high_1 (Length: 280)
Name: NF3716_high_1
Description: NF3716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3716_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 10 - 253
Target Start/End: Original strand, 18876337 - 18876581
Alignment:
| Q |
10 |
atatgaaggaaaggtcaccattcaaaaatataaaataaaatggg-ttgaaactgtccacaagggctctcctctgcaacaagggctatgtagtataatgat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||| |||| || |
|
|
| T |
18876337 |
atatgaaggaaaggtcaccattcaaaaatataaaataaaatgggtttgaaactgtccacaagggctctcctctccaacaggggctatgtaatata---at |
18876433 |
T |
 |
| Q |
109 |
gggtctacagttttcattttgttttcattgatgtttgacnnnnnnnnnnnnnntagttccccattcccatgcatggagttttgctatagtctatg---ta |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
18876434 |
gggtctacagttttcattttgttttcattgatgtttgacaaaaaaataaaaaatagtttcccattcccatgcatggagttttgctatagcctatgcatta |
18876533 |
T |
 |
| Q |
206 |
ttacgctccatgtttggatatacacaacaatggtgggtcatgcaattg |
253 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18876534 |
ttacgctcaatgtttggatatacacaacaatggtgggtcatgcaattg |
18876581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University