View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3718_high_21 (Length: 203)

Name: NF3718_high_21
Description: NF3718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3718_high_21
NF3718_high_21
[»] chr5 (1 HSPs)
chr5 (50-112)||(30751922-30751984)
[»] chr7 (1 HSPs)
chr7 (50-118)||(16179130-16179197)
[»] chr1 (1 HSPs)
chr1 (50-118)||(47648601-47648668)


Alignment Details
Target: chr5 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 50 - 112
Target Start/End: Complemental strand, 30751984 - 30751922
Alignment:
Q  50 gacacattgaatattaattcgattatgtttgaaattgaaggtcaagtatggatgattcaacta 112  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  30751984 gacacatttaatattaattcgattatgtttgaaattgaaggtcaagtatggatgattaaacta 30751922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 50 - 118
Target Start/End: Complemental strand, 16179197 - 16179130
Alignment:
Q  50 gacacattgaatattaattcgattatgtttgaaattgaaggtcaagtatggatgattcaactacttcac 118  Q
    |||||||| ||||||||||||| |||||| ||||||| |||||||||| ||||||||||||| ||||||    
T  16179197 gacacattaaatattaattcgactatgtt-gaaattgcaggtcaagtaaggatgattcaactgcttcac 16179130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 50 - 118
Target Start/End: Complemental strand, 47648668 - 47648601
Alignment:
Q  50 gacacattgaatattaattcgattatgtttgaaattgaaggtcaagtatggatgattcaactacttcac 118  Q
    |||||||| | |||||||||||||||||| ||||||| |||||||||| ||||||||||||| ||||||    
T  47648668 gacacattaactattaattcgattatgtt-gaaattgcaggtcaagtaaggatgattcaactgcttcac 47648601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University