View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3718_high_9 (Length: 388)
Name: NF3718_high_9
Description: NF3718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3718_high_9 |
 |  |
|
| [»] scaffold0325 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 1 - 371
Target Start/End: Original strand, 38229352 - 38229722
Alignment:
| Q |
1 |
tttcaaaaatcttaatagcagaggctaaattgacggatttcatatagtttagggactaaatttattattatacttacatagtttagggagaaaattggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38229352 |
tttcaaaaatcttaatagcagaggctaaattgacggatttcatatagtttagggactaaatttattattatacttacatagtttagggagaaaattggag |
38229451 |
T |
 |
| Q |
101 |
acagggtgatagtttagggactaaattgatgattttctcacctaggcaattgaagatcggtaaccagaacggaaatgaggctataaacatctttgatgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38229452 |
acagggtgatagtttagggactaaattaatgattttctcacctaggcaattgaagaccggtaaccagaacggaaatgaggctataaacatctttgatgtg |
38229551 |
T |
 |
| Q |
201 |
tgcatggagatcatcctccttctcacaattcagaagaacccctaggcagtgaagctttacacacataaacaacagaaacagttcatcaaacttttcattc |
300 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38229552 |
tacatggagatcatcctccttctcacaattcagaagaacccctaggcagtgaagctttacagacataaacaacagaaacagttcatcaaacttttcattc |
38229651 |
T |
 |
| Q |
301 |
actttataaacttatagtaacattttattttatagaggaattcgactatgtgcaaagcttaacaagtaact |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38229652 |
actttataaacttatagtaacattttattttatagaggaattcgactatgtgcaaagcttaacaagtaact |
38229722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 79 - 131
Target Start/End: Original strand, 32576183 - 32576235
Alignment:
| Q |
79 |
tagtttagggagaaaattggagacagggtgatagtttagggactaaattgatg |
131 |
Q |
| |
|
||||||||||| |||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
32576183 |
tagtttagggactaaattggagagagactgatagtttagggactaaattgatg |
32576235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 92 - 131
Target Start/End: Original strand, 35145092 - 35145131
Alignment:
| Q |
92 |
aaattggagacagggtgatagtttagggactaaattgatg |
131 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
35145092 |
aaatttgagacagggtgatagttcagggactaaattgatg |
35145131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 69 - 135
Target Start/End: Original strand, 3675429 - 3675495
Alignment:
| Q |
69 |
tatacttacatagtttagggagaaaattggagacagggtgatagtttagggactaaattgatgattt |
135 |
Q |
| |
|
|||| ||| ||||||||| | ||| ||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
3675429 |
tatatttatatagtttagaggtaaagttggagagagaatgatagtttagggactaaattgatgattt |
3675495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0325 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0325
Description:
Target: scaffold0325; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 62
Target Start/End: Original strand, 8032 - 8069
Alignment:
| Q |
25 |
ctaaattgacggatttcatatagtttagggactaaatt |
62 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||| |
|
|
| T |
8032 |
ctaaattgacggattttatgtagtttagggactaaatt |
8069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 92 - 128
Target Start/End: Complemental strand, 42403395 - 42403359
Alignment:
| Q |
92 |
aaattggagacagggtgatagtttagggactaaattg |
128 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||| |
|
|
| T |
42403395 |
aaattggagagagagtgatagtttagggactaaattg |
42403359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University