View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3718_low_18 (Length: 249)
Name: NF3718_low_18
Description: NF3718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3718_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 31503352 - 31503112
Alignment:
| Q |
1 |
ctttggtggaccggggataaagaggtgattgaagccgactaagcgttgaaataggacatttttaagtgtgattcagctatggtgataagaagacgatgtt |
100 |
Q |
| |
|
|||||||||| |||||||||||||||| | |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31503352 |
ctttggtggatcggggataaagaggtggtggaagtcgactaagcgttgaaataggacatttttgagtgtgattcagctatggtgataagaagacgatgtt |
31503253 |
T |
 |
| Q |
101 |
tgatttagaatggnnnnnnnnnnnnnnnggtgagcagcggacgaagggggtttgtaaggttttcatttgcagtggc-tgtttgcgatggagtttgattta |
199 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31503252 |
tgatttagaatg---tttttttttttttggtgagcagcgggcgaagggggtttgtaaggttttcatttgcagtggcgcgtttgcgatggagtttgattta |
31503156 |
T |
 |
| Q |
200 |
gatggtaaagtttgttttggtggttcttattctcatgcatgttg |
243 |
Q |
| |
|
| ||| ||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
31503155 |
ggtggcgaagttggttttggtggttcttgttctcatgcgtgttg |
31503112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 129 - 224
Target Start/End: Complemental strand, 17819667 - 17819574
Alignment:
| Q |
129 |
ggtgagcagcggacgaagggggtttgtaaggttttcatttgcagtggctgtttgcgatggagtttgatttagatggtaaagtttgttttggtggtt |
224 |
Q |
| |
|
||||||||||| |||||||||||| | || |||| ||| |||||| |||||||||||||||||||||||| |||| ||||| |||||||||||| |
|
|
| T |
17819667 |
ggtgagcagcgagcgaagggggtttat--ggatttcgttttcagtggttgtttgcgatggagtttgatttaggtggtgaagttggttttggtggtt |
17819574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 48567617 - 48567555
Alignment:
| Q |
1 |
ctttggtggaccggggataaagaggtgattgaagccgactaagcgttgaaataggacattttt |
63 |
Q |
| |
|
|||||||||| | |||||| ||||||| | ||||| |||||||||||| ||||| |||||||| |
|
|
| T |
48567617 |
ctttggtggatcagggatagagaggtggtggaagctgactaagcgttggaatagaacattttt |
48567555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 236
Target Start/End: Complemental strand, 15126919 - 15126854
Alignment:
| Q |
171 |
agtggctgtttgcgatggagtttgatttagatggtaaagtttgttttggtggttcttattctcatg |
236 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||| | ||| |||| |||||| || |||||||| |
|
|
| T |
15126919 |
agtggctgtttgcaatggagtttgatttaggtggtgatgttgttttttgtggttgttgttctcatg |
15126854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 31424496 - 31424544
Alignment:
| Q |
173 |
tggctgtttgcgatggagtttgatttagatggtaaagtttgttttggtg |
221 |
Q |
| |
|
||||||||| ||||||||||||||||| |||| ||||| ||||||||| |
|
|
| T |
31424496 |
tggctgtttatgatggagtttgatttaggtggtgaagttggttttggtg |
31424544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University