View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3719_high_22 (Length: 256)
Name: NF3719_high_22
Description: NF3719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3719_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 3 - 107
Target Start/End: Original strand, 47036850 - 47036954
Alignment:
| Q |
3 |
tggaggagcagagagcattcacatgacaaccgataaacataactgcatttatcataaatataataccgacatgactctgtaattgtgctcctgattcttt |
102 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47036850 |
tggaggagaagagagcattcacatgacaaccgataaacataactgcatttatcataaatataataccgacatgactctgtaattgtgctcctgattcttt |
47036949 |
T |
 |
| Q |
103 |
ttcat |
107 |
Q |
| |
|
||||| |
|
|
| T |
47036950 |
ttcat |
47036954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 171 - 256
Target Start/End: Original strand, 47037019 - 47037104
Alignment:
| Q |
171 |
tcttgatggtccctactcataaaaaacaaatggaatggtaagctccaaaacactctttgagattgagcactactattctttcacct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47037019 |
tcttgatggtccctactcataaaaaacaaatggtatggtaagctccaaaacactctttgagattgagcactactattctttcacct |
47037104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University