View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3719_high_25 (Length: 250)
Name: NF3719_high_25
Description: NF3719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3719_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 69 - 234
Target Start/End: Original strand, 11038079 - 11038244
Alignment:
| Q |
69 |
tcaatgatattgaactaaattttataataaaaatgattgcatgtcacaagacggagcatatagttgcatgtgacaattgagggaagttattattgttatc |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11038079 |
tcaatgatattgaactaaattttataataaaaatgattgcatgtgacaagacggagcatatagttgcatgtgacaattgagggaagttattattgttatc |
11038178 |
T |
 |
| Q |
169 |
atgtaaagccatgtgatgcagtcatgtgatgctggatctttctatgtcaatgtcagatcttcttgt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11038179 |
atgtaaagccatgtgatgcagtcatgtgatgctggatctttctatgtcaatgtcagatcttcttgt |
11038244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University