View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3719_low_23 (Length: 308)
Name: NF3719_low_23
Description: NF3719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3719_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 66 - 295
Target Start/End: Original strand, 51178780 - 51179009
Alignment:
| Q |
66 |
tcttcataaaattataagaactcagattttcagtcgaggaatgaaggagtaggcttagagcttatgctttgaactggtggctacatattaggtaatggtt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51178780 |
tcttcataaaattataagaactcagattttcagtcgagaaatgaaggagtaggcttagagcttatgctttgaactggtggctacatattaggtaatggtt |
51178879 |
T |
|
| Q |
166 |
ggtaatggccactttatcgttttaatttacttgcataatttaggtcgaaaacatggtcctctatctaatggaccaatttccaccatcaaaaaccagtatc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51178880 |
ggtaatggccactttatcgttttaatttacttgcataatttaggtcgaaaacatggtcctctatctaatggaccaatttccaccttcaaaaaccagtatc |
51178979 |
T |
|
| Q |
266 |
attttctatattttaaaaatcttccagctc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
51178980 |
attttctatattttaaaaatcttccagctc |
51179009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 51178708 - 51178743
Alignment:
| Q |
16 |
gaataatccagaatggtagatgctgattggggtagg |
51 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51178708 |
gaataatccagaatagtagatgctgattggggtagg |
51178743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University