View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3719_low_27 (Length: 253)
Name: NF3719_low_27
Description: NF3719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3719_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 3588322 - 3588543
Alignment:
| Q |
19 |
gtgttagacttgaaagataaataggctaaagtctgggnnnnnnn--ataactaaatgaccaacgataaaaacaccgacttagtttatatttagtataaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3588322 |
gtgttagacttgaaagataaataggctaaagtctggttttttttttataactaaatgacaaacgataaaaacactgacttagtttatatttagtataaga |
3588421 |
T |
|
| Q |
117 |
catatttaaacccaagcaaaatgcttacatgtcatacagtctcaacagattacctaatctattttcatacctaactgtgttcatcaaagggcaattaacc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3588422 |
catatttaaacccaagcaaaatgcttacatgtcatacagtctcaacagattacctaatctattttcatacctaactgtgttcatcaaagggcaattaacc |
3588521 |
T |
|
| Q |
217 |
attaaaaatttgataaaaccac |
238 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
3588522 |
attaaaaatatgataaaaccac |
3588543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University