View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3719_low_30 (Length: 240)

Name: NF3719_low_30
Description: NF3719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3719_low_30
NF3719_low_30
[»] chr4 (78 HSPs)
chr4 (16-209)||(54730183-54730376)
chr4 (39-216)||(16911519-16911695)
chr4 (43-216)||(16408605-16408777)
chr4 (42-216)||(21646924-21647097)
chr4 (33-216)||(20224935-20225113)
chr4 (134-216)||(20225125-20225207)
chr4 (134-216)||(23501838-23501920)
chr4 (39-216)||(48598829-48599001)
chr4 (34-216)||(6430630-6430808)
chr4 (39-216)||(5648216-5648389)
chr4 (134-216)||(13256403-13256485)
chr4 (134-216)||(20639662-20639743)
chr4 (39-216)||(30639337-30639510)
chr4 (39-216)||(47528534-47528706)
chr4 (134-216)||(29207902-29207982)
chr4 (58-216)||(40915805-40915959)
chr4 (134-210)||(54175114-54175190)
chr4 (129-216)||(25629095-25629180)
chr4 (144-216)||(33836491-33836563)
chr4 (102-206)||(20405106-20405210)
chr4 (138-209)||(30352591-30352662)
chr4 (137-216)||(44363134-44363213)
chr4 (49-216)||(8473624-8473788)
chr4 (39-216)||(11054152-11054324)
chr4 (134-207)||(20908649-20908721)
chr4 (163-216)||(32484311-32484364)
chr4 (39-216)||(5306664-5306841)
chr4 (134-216)||(9832317-9832397)
chr4 (134-208)||(30690188-30690260)
chr4 (134-216)||(47444008-47444088)
chr4 (134-216)||(51865042-51865122)
chr4 (163-216)||(38755912-38755965)
chr4 (163-216)||(38786687-38786740)
chr4 (129-216)||(10277761-10277846)
chr4 (166-216)||(40553941-40553991)
chr4 (163-216)||(11394930-11394983)
chr4 (163-216)||(11404657-11404710)
chr4 (92-201)||(17043413-17043519)
chr4 (67-200)||(25463107-25463237)
chr4 (68-217)||(39077799-39077943)
chr4 (134-216)||(2813176-2813259)
chr4 (129-210)||(9987844-9987923)
chr4 (134-211)||(19027899-19027974)
chr4 (134-204)||(30581481-30581550)
chr4 (170-216)||(35532077-35532123)
chr4 (134-199)||(49796848-49796911)
chr4 (163-204)||(14983912-14983953)
chr4 (134-207)||(21489138-21489210)
chr4 (163-216)||(25388254-25388307)
chr4 (134-210)||(35567221-35567295)
chr4 (134-216)||(7909284-7909365)
chr4 (39-201)||(10660361-10660521)
chr4 (39-201)||(10874506-10874666)
chr4 (37-121)||(17315394-17315478)
chr4 (134-202)||(39029078-39029145)
chr4 (134-210)||(48327773-48327849)
chr4 (40-119)||(14590795-14590874)
chr4 (163-210)||(28494229-28494276)
chr4 (137-216)||(36816388-36816466)
chr4 (163-206)||(47482864-47482907)
chr4 (143-202)||(49938611-49938669)
chr4 (169-216)||(56322984-56323031)
chr4 (163-216)||(44718645-44718698)
chr4 (138-210)||(16494272-16494344)
chr4 (165-200)||(3580860-3580895)
chr4 (163-210)||(19027989-19028036)
chr4 (163-210)||(32478802-32478848)
chr4 (167-210)||(50555666-50555709)
chr4 (163-210)||(54967098-54967144)
chr4 (164-210)||(487136-487182)
chr4 (162-208)||(37038135-37038181)
chr4 (164-217)||(48033405-48033458)
chr4 (89-121)||(23580304-23580336)
chr4 (41-121)||(30352687-30352767)
chr4 (134-209)||(30496333-30496406)
chr4 (129-197)||(46082789-46082856)
chr4 (134-217)||(47441533-47441614)
chr4 (164-208)||(51420662-51420706)
[»] chr5 (54 HSPs)
chr5 (39-216)||(38879538-38879714)
chr5 (39-216)||(4619108-4619284)
chr5 (39-216)||(43334159-43334335)
chr5 (42-216)||(8169988-8170157)
chr5 (39-216)||(41014276-41014449)
chr5 (39-216)||(24448847-24449021)
chr5 (134-216)||(13801771-13801853)
chr5 (39-217)||(27328709-27328886)
chr5 (39-216)||(35710270-35710442)
chr5 (89-216)||(32703431-32703553)
chr5 (134-216)||(20135655-20135737)
chr5 (149-216)||(25622524-25622591)
chr5 (134-223)||(7368447-7368534)
chr5 (129-209)||(12006339-12006419)
chr5 (134-216)||(34154818-34154898)
chr5 (143-216)||(16957374-16957445)
chr5 (163-216)||(16028628-16028681)
chr5 (134-210)||(43574657-43574731)
chr5 (130-208)||(12477132-12477209)
chr5 (39-216)||(1565388-1565562)
chr5 (134-210)||(16880657-16880731)
chr5 (163-216)||(30877568-30877621)
chr5 (134-208)||(7097772-7097844)
chr5 (134-214)||(42924836-42924918)
chr5 (164-210)||(10943855-10943900)
chr5 (140-210)||(12575670-12575739)
chr5 (134-207)||(19142956-19143027)
chr5 (132-206)||(22187334-22187408)
chr5 (140-216)||(1405244-1405318)
chr5 (163-216)||(22861673-22861726)
chr5 (163-216)||(39801594-39801647)
chr5 (145-201)||(10306493-10306548)
chr5 (134-210)||(11657709-11657784)
chr5 (134-210)||(29334446-29334521)
chr5 (33-121)||(37024650-37024738)
chr5 (39-197)||(2838735-2838890)
chr5 (169-216)||(32354211-32354258)
chr5 (163-209)||(21784343-21784389)
chr5 (133-213)||(1850689-1850767)
chr5 (134-210)||(3771390-3771464)
chr5 (163-208)||(4654427-4654472)
chr5 (169-210)||(13774949-13774990)
chr5 (134-210)||(208937-209012)
chr5 (134-200)||(22600505-22600569)
chr5 (163-217)||(30006403-30006457)
chr5 (163-200)||(24323725-24323762)
chr5 (163-200)||(24360349-24360386)
chr5 (134-213)||(9794385-9794462)
chr5 (166-210)||(19093894-19093938)
chr5 (176-208)||(19438757-19438789)
chr5 (33-121)||(23974732-23974819)
chr5 (166-210)||(24903706-24903750)
chr5 (129-208)||(31694120-31694197)
chr5 (143-207)||(39079764-39079827)
[»] chr2 (59 HSPs)
chr2 (32-216)||(14530268-14530451)
chr2 (39-216)||(10543655-10543831)
chr2 (39-216)||(9671137-9671310)
chr2 (39-216)||(8455320-8455494)
chr2 (89-209)||(5841035-5841154)
chr2 (39-216)||(21779265-21779437)
chr2 (39-206)||(17896216-17896381)
chr2 (39-216)||(23397723-23397895)
chr2 (134-216)||(10546214-10546294)
chr2 (39-216)||(11514393-11514566)
chr2 (39-213)||(19977721-19977892)
chr2 (39-216)||(24200627-24200803)
chr2 (39-210)||(12023929-12024096)
chr2 (34-216)||(25079721-25079901)
chr2 (35-216)||(25249742-25249919)
chr2 (89-208)||(14444736-14444851)
chr2 (134-216)||(36871543-36871622)
chr2 (104-211)||(17471570-17471676)
chr2 (136-217)||(24859991-24860070)
chr2 (163-216)||(34080179-34080232)
chr2 (163-216)||(41409940-41409993)
chr2 (139-215)||(23488537-23488613)
chr2 (134-207)||(24890462-24890533)
chr2 (130-208)||(44449395-44449472)
chr2 (163-216)||(40579753-40579806)
chr2 (94-210)||(4516361-4516474)
chr2 (39-208)||(14544020-14544189)
chr2 (166-209)||(3633719-3633762)
chr2 (130-216)||(25632556-25632640)
chr2 (163-206)||(34766333-34766376)
chr2 (134-216)||(40762238-40762318)
chr2 (163-216)||(1289100-1289154)
chr2 (134-208)||(19615043-19615116)
chr2 (144-214)||(31158445-31158515)
chr2 (162-216)||(31525783-31525837)
chr2 (135-216)||(40416875-40416954)
chr2 (172-217)||(124917-124962)
chr2 (162-207)||(4794879-4794924)
chr2 (134-214)||(26684626-26684704)
chr2 (134-210)||(44643574-44643648)
chr2 (172-216)||(22371199-22371243)
chr2 (169-217)||(39189507-39189555)
chr2 (165-208)||(8575975-8576018)
chr2 (134-204)||(13245111-13245179)
chr2 (134-216)||(17668053-17668133)
chr2 (140-214)||(25641558-25641630)
chr2 (129-214)||(30826082-30826164)
chr2 (57-209)||(21377085-21377233)
chr2 (134-217)||(7214585-7214668)
chr2 (134-216)||(17623615-17623695)
chr2 (140-203)||(19185760-19185823)
chr2 (134-184)||(22371105-22371153)
chr2 (134-200)||(32781308-32781372)
chr2 (135-204)||(99281-99348)
chr2 (39-121)||(17705452-17705534)
chr2 (163-204)||(24059012-24059053)
chr2 (163-216)||(39914310-39914362)
chr2 (179-207)||(31523325-31523353)
chr2 (129-208)||(31821355-31821432)
[»] chr6 (36 HSPs)
chr6 (39-216)||(29355859-29356036)
chr6 (39-216)||(1346921-1347093)
chr6 (39-216)||(1354761-1354933)
chr6 (49-216)||(12221918-12222085)
chr6 (130-216)||(2166414-2166500)
chr6 (130-216)||(2178047-2178133)
chr6 (39-208)||(9161080-9161247)
chr6 (140-216)||(12892064-12892140)
chr6 (134-216)||(26097209-26097289)
chr6 (134-216)||(25557774-25557854)
chr6 (146-216)||(14975094-14975164)
chr6 (139-216)||(3116133-3116210)
chr6 (139-216)||(12885967-12886044)
chr6 (163-216)||(6808473-6808526)
chr6 (134-207)||(7947384-7947456)
chr6 (51-188)||(6024202-6024338)
chr6 (163-209)||(23930138-23930184)
chr6 (134-203)||(32579476-32579543)
chr6 (163-216)||(13267803-13267856)
chr6 (129-210)||(2755430-2755513)
chr6 (163-210)||(10734915-10734962)
chr6 (163-210)||(11395839-11395886)
chr6 (39-210)||(3815087-3815255)
chr6 (167-217)||(30786377-30786427)
chr6 (145-206)||(19340889-19340949)
chr6 (163-204)||(24097655-24097696)
chr6 (141-216)||(383764-383837)
chr6 (42-121)||(14975176-14975255)
chr6 (165-204)||(20906802-20906841)
chr6 (134-216)||(17432397-17432479)
chr6 (136-213)||(28007679-28007753)
chr6 (163-207)||(15866052-15866096)
chr6 (134-202)||(24734693-24734760)
chr6 (165-201)||(29016301-29016337)
chr6 (134-209)||(33138884-33138957)
chr6 (167-207)||(33922870-33922910)
[»] chr3 (60 HSPs)
chr3 (39-216)||(13628794-13628971)
chr3 (39-216)||(46421038-46421215)
chr3 (39-216)||(13730606-13730782)
chr3 (39-216)||(29366724-29366900)
chr3 (134-216)||(353353-353435)
chr3 (39-201)||(8247706-8247867)
chr3 (134-216)||(49013477-49013559)
chr3 (39-216)||(1217069-1217241)
chr3 (92-210)||(14986989-14987106)
chr3 (39-216)||(40272816-40272990)
chr3 (39-216)||(39203495-39203667)
chr3 (40-216)||(22122921-22123092)
chr3 (88-216)||(31592877-31593000)
chr3 (134-216)||(54484764-54484844)
chr3 (89-208)||(10795435-10795553)
chr3 (34-216)||(22609741-22609918)
chr3 (134-216)||(45786218-45786300)
chr3 (39-216)||(52926223-52926388)
chr3 (134-210)||(34771374-34771448)
chr3 (34-210)||(7696902-7697068)
chr3 (39-203)||(9607182-9607345)
chr3 (134-216)||(15797293-15797373)
chr3 (129-208)||(54374357-54374435)
chr3 (39-216)||(12914039-12914213)
chr3 (47-216)||(26869694-26869859)
chr3 (33-216)||(5173723-5173905)
chr3 (134-209)||(6411833-6411906)
chr3 (129-210)||(45948848-45948927)
chr3 (163-216)||(24851305-24851358)
chr3 (163-216)||(30452895-30452948)
chr3 (89-207)||(34420656-34420772)
chr3 (68-216)||(516417-516565)
chr3 (34-216)||(16735415-16735593)
chr3 (134-208)||(26573200-26573272)
chr3 (140-210)||(829452-829521)
chr3 (134-204)||(33926155-33926224)
chr3 (132-216)||(25517174-25517256)
chr3 (134-210)||(53996575-53996650)
chr3 (165-216)||(10484620-10484671)
chr3 (39-121)||(10870047-10870129)
chr3 (135-208)||(25944543-25944615)
chr3 (172-216)||(47624208-47624252)
chr3 (89-157)||(45620889-45620957)
chr3 (141-210)||(26292410-26292477)
chr3 (163-216)||(24577935-24577988)
chr3 (165-206)||(46169981-46170022)
chr3 (164-200)||(30928167-30928203)
chr3 (134-210)||(45139488-45139562)
chr3 (177-216)||(4495680-4495719)
chr3 (163-206)||(35418004-35418047)
chr3 (163-210)||(44403565-44403612)
chr3 (134-184)||(47624114-47624162)
chr3 (177-216)||(54032575-54032614)
chr3 (174-216)||(6242289-6242331)
chr3 (175-216)||(31831298-31831339)
chr3 (179-216)||(40390357-40390394)
chr3 (134-217)||(7943063-7943144)
chr3 (166-206)||(40968621-40968661)
chr3 (164-208)||(45288067-45288111)
chr3 (134-210)||(55401249-55401324)
[»] chr1 (65 HSPs)
chr1 (42-209)||(30395737-30395903)
chr1 (39-216)||(34725102-34725274)
chr1 (39-216)||(20004094-20004270)
chr1 (39-210)||(14617018-14617186)
chr1 (82-216)||(35253191-35253320)
chr1 (39-216)||(10668200-10668381)
chr1 (39-216)||(18944623-18944800)
chr1 (39-216)||(38478286-38478458)
chr1 (42-207)||(12126850-12127010)
chr1 (39-208)||(32632569-32632734)
chr1 (134-216)||(4349712-4349792)
chr1 (58-206)||(27201646-27201793)
chr1 (134-216)||(35005197-35005279)
chr1 (134-216)||(42304211-42304293)
chr1 (146-216)||(50606487-50606557)
chr1 (39-216)||(46247957-46248131)
chr1 (134-210)||(18741967-18742043)
chr1 (40-216)||(19414420-19414591)
chr1 (39-215)||(23768325-23768498)
chr1 (57-200)||(18724565-18724705)
chr1 (130-216)||(31382218-31382302)
chr1 (39-213)||(47214491-47214660)
chr1 (134-210)||(10378745-10378819)
chr1 (163-216)||(27474381-27474434)
chr1 (134-210)||(35117775-35117852)
chr1 (39-216)||(46991784-46991958)
chr1 (139-216)||(45402175-45402250)
chr1 (39-217)||(45812540-45812713)
chr1 (132-216)||(1517315-1517397)
chr1 (89-209)||(6925130-6925247)
chr1 (134-216)||(41319810-41319890)
chr1 (134-208)||(19701644-19701717)
chr1 (134-208)||(19932765-19932839)
chr1 (134-208)||(45264411-45264484)
chr1 (134-210)||(9939535-9939612)
chr1 (134-210)||(23796539-23796613)
chr1 (89-211)||(2435795-2435915)
chr1 (163-215)||(4587568-4587620)
chr1 (135-210)||(20999860-20999933)
chr1 (89-200)||(11596543-11596650)
chr1 (134-210)||(43768213-43768287)
chr1 (134-209)||(15505638-15505710)
chr1 (135-207)||(19974087-19974158)
chr1 (134-210)||(31442399-31442474)
chr1 (163-207)||(33594144-33594188)
chr1 (137-208)||(7074593-7074663)
chr1 (165-208)||(16120819-16120862)
chr1 (163-210)||(30555216-30555263)
chr1 (134-208)||(22324966-22325039)
chr1 (166-216)||(25554746-25554796)
chr1 (133-210)||(35019303-35019377)
chr1 (163-200)||(20169109-20169146)
chr1 (134-210)||(44485120-44485193)
chr1 (41-121)||(45402077-45402156)
chr1 (140-210)||(6983821-6983889)
chr1 (134-210)||(15511158-15511235)
chr1 (138-204)||(6358199-6358264)
chr1 (170-204)||(19386592-19386626)
chr1 (39-121)||(22930163-22930245)
chr1 (34-100)||(34714598-34714664)
chr1 (167-208)||(28894570-28894611)
chr1 (163-200)||(30682913-30682950)
chr1 (179-216)||(42432228-42432265)
chr1 (134-207)||(50812014-50812085)
chr1 (134-210)||(39214968-39215043)
[»] chr8 (51 HSPs)
chr8 (39-216)||(39460998-39461174)
chr8 (39-210)||(12670260-12670426)
chr8 (39-210)||(7136537-7136707)
chr8 (39-216)||(13160659-13160832)
chr8 (58-216)||(26954108-26954266)
chr8 (49-216)||(6760789-6760955)
chr8 (40-210)||(20284079-20284250)
chr8 (34-216)||(30454101-30454278)
chr8 (39-216)||(2626476-2626653)
chr8 (40-210)||(21070707-21070879)
chr8 (33-216)||(17823527-17823707)
chr8 (134-216)||(20869974-20870056)
chr8 (30-208)||(36720744-36720919)
chr8 (39-216)||(45071222-45071395)
chr8 (33-216)||(28817630-28817810)
chr8 (134-210)||(16225070-16225146)
chr8 (137-216)||(25250576-25250655)
chr8 (39-210)||(44530106-44530274)
chr8 (34-216)||(18164764-18164942)
chr8 (39-216)||(35261636-35261810)
chr8 (129-208)||(8897776-8897853)
chr8 (134-216)||(19729391-19729471)
chr8 (134-208)||(29877145-29877217)
chr8 (59-209)||(24365071-24365218)
chr8 (42-197)||(20869523-20869671)
chr8 (134-207)||(44781517-44781590)
chr8 (39-215)||(29521690-29521863)
chr8 (134-216)||(12625941-12626021)
chr8 (140-210)||(16013511-16013581)
chr8 (89-210)||(5135300-5135417)
chr8 (134-207)||(17250888-17250961)
chr8 (163-216)||(26102595-26102648)
chr8 (134-213)||(389696-389773)
chr8 (135-210)||(8483948-8484021)
chr8 (129-216)||(31457218-31457303)
chr8 (134-216)||(10857880-10857960)
chr8 (163-210)||(27507988-27508035)
chr8 (134-215)||(5689682-5689761)
chr8 (171-216)||(27468096-27468141)
chr8 (163-216)||(28407481-28407534)
chr8 (134-210)||(44742528-44742603)
chr8 (163-216)||(35107315-35107368)
chr8 (165-217)||(18595918-18595970)
chr8 (130-206)||(30231344-30231419)
chr8 (129-210)||(26457775-26457852)
chr8 (163-201)||(24245527-24245565)
chr8 (134-176)||(43942375-43942417)
chr8 (177-210)||(23286347-23286380)
chr8 (163-216)||(36486570-36486623)
chr8 (164-209)||(40444845-40444890)
chr8 (49-121)||(28407383-28407455)
[»] chr7 (54 HSPs)
chr7 (39-216)||(42805481-42805657)
chr7 (39-216)||(21172013-21172185)
chr7 (33-216)||(32758212-32758390)
chr7 (89-216)||(47716466-47716592)
chr7 (34-210)||(2541029-2541203)
chr7 (43-216)||(10693077-10693245)
chr7 (39-191)||(46354151-46354302)
chr7 (39-216)||(48735126-48735299)
chr7 (39-216)||(43557429-43557606)
chr7 (68-216)||(42391104-42391247)
chr7 (49-216)||(19426894-19427057)
chr7 (39-216)||(42798626-42798800)
chr7 (44-216)||(27629596-27629765)
chr7 (134-216)||(7879689-7879769)
chr7 (89-216)||(29907426-29907549)
chr7 (43-216)||(11617592-11617762)
chr7 (39-217)||(47077858-47078031)
chr7 (42-209)||(40463837-40464000)
chr7 (139-210)||(21566491-21566561)
chr7 (135-216)||(27889320-27889399)
chr7 (144-216)||(38262200-38262270)
chr7 (135-208)||(39123945-39124018)
chr7 (89-210)||(16341285-16341404)
chr7 (129-216)||(18512457-18512542)
chr7 (130-217)||(33871913-33871998)
chr7 (39-210)||(22698977-22699148)
chr7 (134-216)||(31591113-31591193)
chr7 (134-210)||(18747538-18747612)
chr7 (134-210)||(19265865-19265938)
chr7 (39-216)||(34626212-34626385)
chr7 (39-208)||(42476830-42476994)
chr7 (129-216)||(11741839-11741924)
chr7 (134-209)||(23231608-23231681)
chr7 (135-208)||(45018935-45019010)
chr7 (163-210)||(35334826-35334873)
chr7 (134-199)||(19266501-19266564)
chr7 (92-210)||(28362156-28362270)
chr7 (134-210)||(38604577-38604652)
chr7 (134-217)||(1408508-1408589)
chr7 (134-214)||(14732827-14732906)
chr7 (130-216)||(23065929-23066013)
chr7 (134-205)||(33500564-33500635)
chr7 (134-216)||(35787273-35787353)
chr7 (169-208)||(42495874-42495913)
chr7 (140-205)||(3469190-3469255)
chr7 (69-206)||(23419688-23419822)
chr7 (134-210)||(39093449-39093524)
chr7 (39-119)||(42495933-42496013)
chr7 (69-121)||(44123717-44123769)
chr7 (134-200)||(13805152-13805216)
chr7 (173-216)||(36602535-36602578)
chr7 (39-121)||(5180253-5180335)
chr7 (39-121)||(18326991-18327073)
chr7 (177-209)||(25434112-25434144)
[»] scaffold0168 (1 HSPs)
scaffold0168 (39-216)||(30536-30708)
[»] scaffold0180 (1 HSPs)
scaffold0180 (134-216)||(24137-24217)
[»] scaffold0057 (4 HSPs)
scaffold0057 (49-216)||(46798-46962)
scaffold0057 (134-206)||(24786-24856)
scaffold0057 (134-207)||(43708-43780)
scaffold0057 (134-206)||(46721-46792)
[»] scaffold0049 (1 HSPs)
scaffold0049 (41-216)||(58936-59110)
[»] scaffold0015 (1 HSPs)
scaffold0015 (134-216)||(48638-48718)
[»] scaffold0258 (1 HSPs)
scaffold0258 (39-216)||(13028-13201)
[»] scaffold0187 (2 HSPs)
scaffold0187 (39-216)||(10054-10226)
scaffold0187 (39-216)||(20382-20554)
[»] scaffold1176 (1 HSPs)
scaffold1176 (130-217)||(1590-1675)
[»] scaffold0311 (1 HSPs)
scaffold0311 (137-207)||(10864-10932)
[»] scaffold0223 (1 HSPs)
scaffold0223 (134-208)||(11180-11252)
[»] scaffold0954 (1 HSPs)
scaffold0954 (134-209)||(3595-3668)
[»] scaffold0031 (1 HSPs)
scaffold0031 (50-121)||(43097-43168)
[»] scaffold0018 (1 HSPs)
scaffold0018 (134-208)||(72879-72951)
[»] scaffold0005 (1 HSPs)
scaffold0005 (40-119)||(226504-226583)
[»] scaffold0254 (1 HSPs)
scaffold0254 (130-183)||(4204-4258)


Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 78)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 16 - 209
Target Start/End: Original strand, 54730183 - 54730376
Alignment:
Q  16 aaaggtaaatgtaatagtttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctc 115  Q
    ||||||||||||||| |||||||||||||| | ||||||| ||||||| || ||||||||||| |||||| | |||||||||||| ||||||||||||||    
T  54730183 aaaggtaaatgtaatggtttgatgggtaactttggcgcaatcggtaaagttgttgtcatgtgaccaaaaggtcacgggttcaagtcctagaaacagcctc 54730282  T
Q  116 ttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    ||||||       ||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||||||||    
T  54730283 ttgtgtaaaaaaataggataaggctgcgtataatacaccaataatgatggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccg 54730376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 16911519 - 16911695
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| ||||||||||||||||||||        ||| |||||    
T  16911519 gggtaaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctagaaacagcctcttgtgtacaaatc-agggtaagg 16911617  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||  ||||||||||||||||||||||| || ||||||||||||||  ||||| |||||    
T  16911618 ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggttgcc 16911695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 43 - 216
Target Start/End: Complemental strand, 16408777 - 16408605
Alignment:
Q  43 aacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgc 142  Q
    ||||| |||||||| |||||| || |||||||||||    ||| | |||||||||||| || |||||||||||||||||        ||| |||| ||||    
T  16408777 aaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agggtaagactgc 16408679  T
Q  143 gtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||| |||||||||||||||| ||||||||||||||||||||||||||| |||||    
T  16408678 gtacaatacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc 16408605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 42 - 216
Target Start/End: Original strand, 21646924 - 21647097
Alignment:
Q  42 taacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctg 141  Q
    |||||| |||||||| |||||| || |||||||||||    ||| | || ||||||||| || |||||||||||||||||       |||| ||||||||    
T  21646924 taaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaaa-tagggtaaggctg 21647022  T
Q  142 cgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||| |||||||||  |||||||||||||| ||||| ||||||||||||||||||||||||||| |||||    
T  21647023 cgtacaatataccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc 21647097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 33 - 216
Target Start/End: Original strand, 20224935 - 20225113
Alignment:
Q  33 tttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntagg 132  Q
    ||||| ||||||||| |||||||| |||||| || |||||||||||   |||| | | |||||||||| || |||||| ||||||||||        |||    
T  20224935 tttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaac---agg 20225031  T
Q  133 ataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
     |||||||||||||||||||||||  ||  |||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  20225032 gtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 20225113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 20225125 - 20225207
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||||||  |||||||||||||||||||| ||||||||||||||||||||||||||| |||||    
T  20225125 taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc 20225207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 23501838 - 23501920
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||| |||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  23501838 taaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcc 23501920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 48599001 - 48598829
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||        ||| |||||    
T  48599001 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac---agggtaagg 48598905  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  ||||||||||||||||||| ||||||||| |||||| ||||||||||| |||||    
T  48598904 ctgcgtacaatacaccaa--atggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgcc 48598829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 34 - 216
Target Start/End: Complemental strand, 6430808 - 6430630
Alignment:
Q  34 ttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntagga 133  Q
    |||| ||||||||| |||||||| |||||| || |||||||||||   |||| | ||||||||||||  | |||||||||||||||||        |||     
T  6430808 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcatggaaacagcctcttgtgtaaaaac--aggg 6430711  T
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  ||||||| ||||||||||||||| |||||||||||||||| ||||||| |||||    
T  6430710 taaggctgcgtacaatacaccaa--atggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgcc 6430630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 5648216 - 5648389
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||    ||| | |||||||||||| || |||||||||||||||||        ||| |||||    
T  5648216 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaac--agggtaagg 5648313  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  ||||||||||||||||||||||| ||||||||||||| ||||||| || |||||    
T  5648314 ctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgcc 5648389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 13256485 - 13256403
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||||||  ||||||||||||||| |||| |||| |||||||||||||||||||||| |||||    
T  13256485 taaggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgcc 13256403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 20639743 - 20639662
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||| |||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  20639743 taaggctgcgtacaatacaccaa-aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 20639662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 30639337 - 30639510
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || ||||| |||||   |||| | || ||||||||| || ||||||| |||||||||        ||| |||||    
T  30639337 gggtaaccttggcgcaactggtaaagttgttgtcttgtgactgaaaggtcactggttcaagtcctggaaacagactcttgtgtaaaaac--agggtaagg 30639434  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  || |||||||||||||||||||||||||||||||||||||||||| || |||||    
T  30639435 ctgcgtacaatacaccaa--atggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgcc 30639510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 47528706 - 47528534
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| || ||||| |||||| || |||||||||||   |||| | || ||||||||| || |||||||||||||||||        ||| |||||    
T  47528706 gggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaac---agggtaagg 47528610  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  |||||||||||||||||||||| ||||| ||||||| ||||||||||| |||||    
T  47528609 ctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggttgcc 47528534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 29207982 - 29207902
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  |||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  29207982 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 29207902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 58 - 216
Target Start/End: Original strand, 40915805 - 40915959
Alignment:
Q  58 ggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaat 157  Q
    |||||| || |||||||||||  | ||| | |||||||||||| || |||||||||||||||||        ||| |||||||||||||||||||||||     
T  40915805 ggtaaagttgttgtcatgtgactataaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaca-agg-taaggctgcgtacaatacaccaa- 40915901  T
Q  158 aatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
     ||  ||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||    
T  40915902 -atggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccggattgcc 40915959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 54175114 - 54175190
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttccc-ggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||||||||| |||  |||||||||||||| ||||||||||||||||||||||||||||||||||    
T  54175114 taaggctgcgtacaatacaccaa-aatggtgggaccccttccccggaccctgcatatgcgggagctttagtgcaccgg 54175190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 129 - 216
Target Start/End: Original strand, 25629095 - 25629180
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||| |||||||| ||||||||||||||  ||  ||||||||||||||||||||| |||||||||||||||||||||||||| |||||    
T  25629095 tagggtaaggctgtgtacaatacaccaa--atggtgggaccccttcccggaccctacatatgcgggagctttagtgcaccgggttgcc 25629180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 144 - 216
Target Start/End: Complemental strand, 33836563 - 33836491
Alignment:
Q  144 tacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||  ||||||||||||||||||||||| |||||||||||||||||||| ||| |||||    
T  33836563 tacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgcc 33836491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 102 - 206
Target Start/End: Original strand, 20405106 - 20405210
Alignment:
Q  102 ctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagcttta 201  Q
    ||||||||||||||||||||        ||| ||||  |||||||||||||| ||||||  |||||||||||||||||||| ||||||||||||||||||    
T  20405106 ctagaaacagcctcttgtgtaaaaaaacagggtaagattgcgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagcttta 20405205  T
Q  202 gtgca 206  Q
    |||||    
T  20405206 gtgca 20405210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 138 - 209
Target Start/End: Complemental strand, 30352662 - 30352591
Alignment:
Q  138 gctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    ||||||||||||||||||| |||  |||||||||||| |||||||||| |||||||||||||||||||||||    
T  30352662 gctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccg 30352591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 137 - 216
Target Start/End: Complemental strand, 44363213 - 44363134
Alignment:
Q  137 ggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||  |||||| |||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  44363213 ggctgcgtacaacgcaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 44363134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 49 - 216
Target Start/End: Complemental strand, 8473788 - 8473624
Alignment:
Q  49 ggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaa 148  Q
    |||||||| |||||| || ||||||| ||| |  ||| || ||||||||||| || |||||||||||||||||        ||| ||||||||| |||||    
T  8473788 ggcgcaactggtaaagttgttgtcatatgaccggaaggttgcgggttcaagtcctggaaacagcctcttgtgtttaac---agggtaaggctgcatacaa 8473692  T
Q  149 tacaccaataatcatgggaccccttccc-ggaccc-tgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||  ||  |||||||||||||| |||||| |||||||||||||||||||||||||||| |||||    
T  8473691 tacaccaa--atggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgcc 8473624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 11054324 - 11054152
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||| | |||||||| |||||| || |||||||||||   |||| | |||||||||||| ||  |||||| |||||||||        ||| ||||     
T  11054324 gggtaactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctgaaaacagtctcttgtgtaaaac---agggtaaga 11054228  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||   || |||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  11054227 ctgcgtacaatacaccaa--atggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 11054152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 134 - 207
Target Start/End: Complemental strand, 20908721 - 20908649
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    ||||||||||||||||||||||| |||  ||||||||||||||| ||||||| |||||||||||||||||||||    
T  20908721 taaggctgcgtacaatacaccaa-aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac 20908649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 32484311 - 32484364
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  32484311 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcc 32484364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 5306841 - 5306664
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| ||  ||||||||||   |||| | |||||||||||| || |||||||||||||||||        ||| |||||    
T  5306841 gggtaaccttggcgcaactggtaaagttgatgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaatc--agggtaagg 5306744  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatg----cgggagctttagtgcaccggattgcc 216  Q
     |||||||||||||||||  ||  ||||||||||||||||||||||| ||||    ||||||||||| |||||||| |||||    
T  5306743 ttgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgtggacgggagctttaatgcaccgggttgcc 5306664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 9832397 - 9832317
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  ||||||||||||||||||||||||||||| ||| || ||||||||||| |||||    
T  9832397 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcaggaactctagtgcaccgggttgcc 9832317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 134 - 208
Target Start/End: Complemental strand, 30690260 - 30690188
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||||| ||||||||||||||  |  ||||||||||||||||||||||| ||||||||||||||||||||||    
T  30690260 taaggctgcatacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcacc 30690188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 47444008 - 47444088
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  ||||||||||||||||||||||||||||| ||||||| ||||||| || |||||    
T  47444008 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcaggagcttcagtgcactgggttgcc 47444088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 51865122 - 51865042
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  |||| |||||||||||||||||| ||||||||||||||| ||||||||| ||||    
T  51865122 taaggctgcgtacaatacaccaa--atggtggggccccttcccggaccctgcgtatgcgggagctttattgcaccggactgcc 51865042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 163 - 216
Target Start/End: Complemental strand, 38755965 - 38755912
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  38755965 tgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 38755912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 38786687 - 38786740
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  38786687 tgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 38786740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 129 - 216
Target Start/End: Complemental strand, 10277846 - 10277761
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||||||||  ||  ||  |||||||||| ||||||||||||||||||| | ||||| |||||||||||    
T  10277846 taggataaggctgcgtacaatacaccaa--atggtgaaaccccttcccagaccctgcatatgcgggagttctagtgaaccggattgcc 10277761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 40553991 - 40553941
Alignment:
Q  166 gaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  40553991 gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 40553941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 11394930 - 11394983
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||| ||||||||||| |||||||||||||||||||||||| |||||    
T  11394930 tgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 11394983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 11404657 - 11404710
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||| ||||||||||| |||||||||||||||||||||||| |||||    
T  11404657 tgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 11404710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 92 - 201
Target Start/End: Complemental strand, 17043519 - 17043413
Alignment:
Q  92 ggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgc 191  Q
    ||||||||| || |||||||||||||||||        ||| |||||||||||||||||||||||  ||  |||||||||||||| ||||||||||||||    
T  17043519 ggttcaagtcctggaaacagcctcttgtgtaaaatac-agggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccagaccctgcatatgc 17043423  T
Q  192 gggagcttta 201  Q
     |||||||||    
T  17043422 tggagcttta 17043413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 67 - 200
Target Start/End: Original strand, 25463107 - 25463237
Alignment:
Q  67 attgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatggg 166  Q
    ||||||||||||   |||| | |||||||||||| || |||||| ||||||||||       | ||| |||| ||||||||| |||||||  ||  ||||    
T  25463107 attgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaactggga-aaggttgcgtacaacacaccaa--atggtggg 25463203  T
Q  167 accccttcccggaccctgcatatgcgggagcttt 200  Q
    ||||||||||||||||||||||||||||||||||    
T  25463204 accccttcccggaccctgcatatgcgggagcttt 25463237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 68 - 217
Target Start/End: Complemental strand, 39077943 - 39077799
Alignment:
Q  68 ttgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatggga 167  Q
    ||||||||||||  |||| | |||||||||||| || |||||||||||||||||        ||| ||||| ||||||||||| |||||  ||  || ||    
T  39077943 ttgtcatgtgattgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac---agggtaaggttgcgtacaatataccaa--atggtgaga 39077849  T
Q  168 ccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    |  ||| |||||||||||||||||||||||| ||||||||||| ||||||    
T  39077848 catctttccggaccctgcatatgcgggagctctagtgcaccgggttgcct 39077799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 2813176 - 2813259
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagcttt-agtgcaccggattgcc 216  Q
    |||| |||||||||||||| |||||||  |||||||| |||||| ||  ||| |||||||||||||| ||||||||||||||||    
T  2813176 taagactgcgtacaatacatcaataatggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccggattgcc 2813259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 129 - 210
Target Start/End: Complemental strand, 9987923 - 9987844
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||| ||||||||| |||||||||||||  ||  |||||||||||||  |||| ||||||||||||||||||| ||||||||    
T  9987923 tagggtaaggctgcatacaatacaccaa--atggtgggaccccttccttgaccttgcatatgcgggagctttaatgcaccgg 9987844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 134 - 211
Target Start/End: Original strand, 19027899 - 19027974
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgga 211  Q
    ||||||||||||||||||||||||  |  ||||||||||| || ||| |||| |||| ||||||||||||||||||||    
T  19027899 taaggctgcgtacaatacaccaat--tggtgggacccctttccagactctgcgtatgtgggagctttagtgcaccgga 19027974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 134 - 204
Target Start/End: Complemental strand, 30581550 - 30581481
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtg 204  Q
    ||||| || |||||||||||||| |||  ||||||||||||||||||||||||||||  ||||||||||||    
T  30581550 taagggtgtgtacaatacaccaa-aatggtgggaccccttcccggaccctgcatatgtaggagctttagtg 30581481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 170 - 216
Target Start/End: Original strand, 35532077 - 35532123
Alignment:
Q  170 ccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||| |||||||||||||||||||||||| |||||    
T  35532077 ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 35532123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 134 - 199
Target Start/End: Original strand, 49796848 - 49796911
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctt 199  Q
    |||||||||||||||||||||||  ||  ||||||||||||||| ||||||| |||||||||||||    
T  49796848 taaggctgcgtacaatacaccaa--atggtgggaccccttcccgaaccctgcgtatgcgggagctt 49796911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 14983912 - 14983953
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtg 204  Q
    ||||||||||||||||||||||| ||||||||||||||||||    
T  14983912 tgggaccccttcccggaccctgcgtatgcgggagctttagtg 14983953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 134 - 207
Target Start/End: Original strand, 21489138 - 21489210
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    |||| ||||||||||| |||||| |||  ||||||||||||||| ||||||| |||||||||||||| ||||||    
T  21489138 taagactgcgtacaatgcaccaa-aatggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtgcac 21489210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 25388254 - 25388307
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||| |||||  ||||||||||||||||| |||||    
T  25388254 tgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgcc 25388307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 35567221 - 35567295
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||| |||||| |||||||  ||  ||||||||||||||| ||||||| | ||||||||||||||||||||||    
T  35567221 taaggctgtgtacaacacaccaa--atggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgg 35567295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 7909365 - 7909284
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgc-gggagctttagtgcaccggattgcc 216  Q
    ||||| |||||||||||||||||  ||  ||||||||||||||| ||||||| ||||| ||||||||||||||| ||| |||||    
T  7909365 taaggttgcgtacaatacaccaa--atggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgcatcgggttgcc 7909284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 39 - 201
Target Start/End: Original strand, 10660361 - 10660521
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| ||||  |||||||| || |||||| |||||| |||       |||| || ||    
T  10660361 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctcttatgtaaaaaa-tagggtatgg 10660459  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagcttta 201  Q
    |||| |||||||||||||||||  || ||||||||||  || ||||| |||||||||||||||    
T  10660460 ctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagcttta 10660521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 39 - 201
Target Start/End: Original strand, 10874506 - 10874666
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| ||||  |||||||| || |||||| |||||| |||       |||| || ||    
T  10874506 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctcttatgtaaaaaa-tagggtatgg 10874604  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagcttta 201  Q
    |||| |||||||||||||||||  || ||||||||||  || ||||| |||||||||||||||    
T  10874605 ctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagcttta 10874666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 37 - 121
Target Start/End: Complemental strand, 17315478 - 17315394
Alignment:
Q  37 atgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgt 121  Q
    ||||||||||| ||||||||||||||| || |||||||||||   |||| | |||||||||| | || |||||| ||||||||||    
T  17315478 atgggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgggttcaattcctcgaaacaacctcttgtgt 17315394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 202
Target Start/End: Complemental strand, 39029145 - 39029078
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttag 202  Q
    |||||||| ||||||||||| || |||  ||||||| ||| ||||||||||||||||||||||||||||    
T  39029145 taaggctgtgtacaatacacgaa-aatggtgggaccactttccggaccctgcatatgcgggagctttag 39029078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 48327849 - 48327773
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||| |||| |||||||||||||||||  ||||||| ||||||| ||||  ||||||||| || |||||||||||||    
T  48327849 taagactgcatacaatacaccaataatggtgggacctcttcccgaaccccacatatgcggaagttttagtgcaccgg 48327773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 40 - 119
Target Start/End: Original strand, 14590795 - 14590874
Alignment:
Q  40 ggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgt 119  Q
    |||||||| |||||||| |||||| || |||||||||||   |||| | |||| ||||||| ||||||||||||||||||    
T  14590795 ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgt 14590874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 28494229 - 28494276
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||| || |||||||||||||||||| |||||||||||    
T  28494229 tgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgg 28494276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 137 - 216
Target Start/End: Complemental strand, 36816466 - 36816388
Alignment:
Q  137 ggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||| ||   |||||| |||||| ||||||||  |||||||||||||||||| ||||| |||||    
T  36816466 ggctgcgtacaatacaccaaaaagg-tgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgcc 36816388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 163 - 206
Target Start/End: Complemental strand, 47482907 - 47482864
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgca 206  Q
    ||||||||||||||||||||||| |||||||||||||| |||||    
T  47482907 tgggaccccttcccggaccctgcgtatgcgggagctttggtgca 47482864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 202
Target Start/End: Complemental strand, 49938669 - 49938611
Alignment:
Q  143 gtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttag 202  Q
    |||||||||||||| |||  ||||||||||||||  ||||||||||||||||||||||||    
T  49938669 gtacaatacaccaa-aatggtgggaccccttcccataccctgcatatgcgggagctttag 49938611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 216
Target Start/End: Original strand, 56322984 - 56323031
Alignment:
Q  169 cccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||| | ||||||||||||||||||||||||| |||||    
T  56322984 cccttcccggaccccggatatgcgggagctttagtgcaccgggttgcc 56323031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 44718645 - 44718698
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||| |||||||| ||||||||||||||||  |||||| |||||    
T  44718645 tgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgcc 44718698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 210
Target Start/End: Original strand, 16494272 - 16494344
Alignment:
Q  138 gctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||| ||||||||||||| |||  |||||||| ||||| |||||||  ||||||| |||||||||| |||||    
T  16494272 gctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcggaagctttagtgtaccgg 16494344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 200
Target Start/End: Complemental strand, 3580895 - 3580860
Alignment:
Q  165 ggaccccttcccggaccctgcatatgcgggagcttt 200  Q
    |||||||||||||||||||||||||| |||||||||    
T  3580895 ggaccccttcccggaccctgcatatgtgggagcttt 3580860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 19027989 - 19028036
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||| |||||||||||||  | ||||||||||||||||||||||||    
T  19027989 tgggactccttcccggaccccacttatgcgggagctttagtgcaccgg 19028036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 163 - 210
Target Start/End: Complemental strand, 32478848 - 32478802
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||||||||| || |||||||||||||| |||||||||    
T  32478848 tgggaccccttcccggacccagcgtatgcgggagcttt-gtgcaccgg 32478802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 167 - 210
Target Start/End: Complemental strand, 50555709 - 50555666
Alignment:
Q  167 accccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||||| ||||| |||| |||||||||||||    
T  50555709 accccttcccggaccctgcgtatgcaggagttttagtgcaccgg 50555666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 54967098 - 54967144
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||| ||||| |||||||||||||||| |||||||||    
T  54967098 tgggaccccttcccgtaccctacatatgcgggagcttt-gtgcaccgg 54967144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 210
Target Start/End: Complemental strand, 487182 - 487136
Alignment:
Q  164 gggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||  ||||  |||||||||||||||||||||||    
T  487182 gggaccccttcccggattctgcgaatgcgggagctttagtgcaccgg 487136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 37038181 - 37038135
Alignment:
Q  162 atgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    |||| ||| ||||||| ||||||| ||||||||||||||||||||||    
T  37038181 atggaacctcttcccgtaccctgcgtatgcgggagctttagtgcacc 37038135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 217
Target Start/End: Original strand, 48033405 - 48033458
Alignment:
Q  164 gggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    ||||||||||   ||||| ||| |||||||||||||||||||||| ||||||||    
T  48033405 gggacccctttgtggaccttgcgtatgcgggagctttagtgcacctgattgcct 48033458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 121
Target Start/End: Complemental strand, 23580336 - 23580304
Alignment:
Q  89 acgggttcaagttctagaaacagcctcttgtgt 121  Q
    |||||||||||||||||||| ||||||||||||    
T  23580336 acgggttcaagttctagaaagagcctcttgtgt 23580304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 121
Target Start/End: Complemental strand, 30352767 - 30352687
Alignment:
Q  41 gtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgt 121  Q
    ||||||| |||||||| |||||| || |||||| |||| | |||| | |||||||  ||| || |||||||||||||||||    
T  30352767 gtaaccttggcgcaactggtaaagttgttgtcaagtgaccgaaaggtcacgggttagagtcctggaaacagcctcttgtgt 30352687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 209
Target Start/End: Complemental strand, 30496406 - 30496333
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    ||||||||| |||||||||||||  ||   ||||| |||||||||||| ||| ||||  |||||||||||||||||    
T  30496406 taaggctgcatacaatacaccaa--atggggggactccttcccggaccgtgcttatgatggagctttagtgcaccg 30496333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 197
Target Start/End: Original strand, 46082789 - 46082856
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagc 197  Q
    |||| ||||||||||||  |||||| ||||||  || ||| ||||| ||||||||||||||||||||||    
T  46082789 taggttaaggctgcgtattatacac-aataatggtgagactccttctcggaccctgcatatgcgggagc 46082856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 217
Target Start/End: Complemental strand, 47441614 - 47441533
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    |||||||| ||||||||||||||  ||  | ||||||||||||||||||||  || || |||||||| || ||||||| |||||    
T  47441614 taaggctgtgtacaatacaccaa--atggttggaccccttcccggaccctgagtaagcaggagctttcgtccaccggactgcct 47441533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 51420662 - 51420706
Alignment:
Q  164 gggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||||||| |||||| ||||||||  ||||||||||||||||    
T  51420662 gggaccccttctcggaccatgcatatgtaggagctttagtgcacc 51420706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 54)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 38879538 - 38879714
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| || ||||||||||||||| |        ||| |||||    
T  38879538 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaac-agggtaagg 38879636  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  38879637 ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 38879714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 4619284 - 4619108
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||    ||| | |||||||||||| || |||| ||||||||||||        ||| |||||    
T  4619284 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaac-agggtaagg 4619186  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||  |||||||||||||||||||| ||||||||| ||||||||||||||||| |||||    
T  4619185 ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgcc 4619108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 43334159 - 43334335
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| || ||||||||||| |||||        ||| |||||    
T  43334159 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaaacagggtaagg 43334258  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||| |||  |||||||||||||||||||||||  ||||||||||||||||||||||| |||||    
T  43334259 ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgc-gatgcgggagctttagtgcaccgggttgcc 43334335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 42 - 216
Target Start/End: Complemental strand, 8170157 - 8169988
Alignment:
Q  42 taacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctg 141  Q
    |||||| |||||||| |||||| || ||||||||||| | |||| | |||||||||||| || |||||||||| ||||||        ||| ||||||||    
T  8170157 taaccttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaac---agggtaaggctg 8170061  T
Q  142 cgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||  ||  |||||||||||||||||||||||||||||||||| || |||||||||| |||||    
T  8170060 cgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgcc 8169988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 41014276 - 41014449
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||    ||| | |||||||||||| || |||||||||||||||||        ||| |||||    
T  41014276 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaac--agggtaagg 41014373  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  ||||||||||||| |||||| ||||||||||||||||||||||||||| |||||    
T  41014374 ctgcgtacaatacaccaa--atggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttgcc 41014449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 24448847 - 24449021
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||    ||| | |||||||||||| || |||||||||| ||||||       |||| |||||    
T  24448847 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaa-tagggtaagg 24448945  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  ||||||||||||||||||||||| ||||| |||||||||||||||||| |||||    
T  24448946 ctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgcc 24449021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 13801853 - 13801771
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||||||  |||||||||||||||||||| ||||||||| ||||||||||||||||| |||||    
T  13801853 taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgcc 13801771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 39 - 217
Target Start/End: Original strand, 27328709 - 27328886
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| | |||||  |||||| || |||||||||||   |||| | || ||||||||| || ||||||| |||||||||        ||| |||||    
T  27328709 gggtaaccttgacgcaattggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagtctcttgtgtaaaaaac-agggtaagg 27328807  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    ||||||||||||||||||||||  ||||||||||||||| ||||||| ||||||||||||||| |||| ||||||||||    
T  27328808 ctgcgtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagctttaatgcatcggattgcct 27328886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 35710270 - 35710442
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || ||||||||| |   |||| | |||||||||||| || |||||||||||||||||       |||| |||||    
T  35710270 gggtaaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa---tagggtaagg 35710366  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||| |||||||||||  ||  ||||||||||||||||| | |||||||||||||||| ||||||||||| |||||    
T  35710367 ctgcgttcaatacaccaa--atggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgcc 35710442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 89 - 216
Target Start/End: Original strand, 32703431 - 32703553
Alignment:
Q  89 acgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcata 188  Q
    |||||||||||| || |||||||||||||||||        ||| |||||||||||||||||||||||  ||  ||||||||||||||||||||||||||    
T  32703431 acgggttcaagtcctggaaacagcctcttgtgtaaaac---agggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcata 32703525  T
Q  189 tgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||| ||||||||||| |||||    
T  32703526 tgcgggagctctagtgcaccgggttgcc 32703553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 20135655 - 20135737
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||||||  |||||||||||||||||||| |||||||| ||||||| |||||||||| |||||    
T  20135655 taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagtgcaccgggttgcc 20135737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 149 - 216
Target Start/End: Original strand, 25622524 - 25622591
Alignment:
Q  149 tacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||  ||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  25622524 tacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcc 25622591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 134 - 223
Target Start/End: Original strand, 7368447 - 7368534
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcctcctttt 223  Q
    ||||||||||||||||||||||||  |  |||||||||||||||||||||||||||| ||||||| ||||||||||| ||||| ||||||    
T  7368447 taaggctgcgtacaatacaccaat--tggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgccccctttt 7368534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 129 - 209
Target Start/End: Complemental strand, 12006419 - 12006339
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    |||| ||||||| | |||||||||||||||||  |||||||||||||| |||||||| |||||||||||||||||||||||    
T  12006419 tagggtaaggctccatacaatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccg 12006339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 34154898 - 34154818
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  ||||||||||||||||||||||||||||||| |||| ||||||||||| |||||    
T  34154898 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcc 34154818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 143 - 216
Target Start/End: Original strand, 16957374 - 16957445
Alignment:
Q  143 gtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||  ||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  16957374 gtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 16957445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 163 - 216
Target Start/End: Complemental strand, 16028681 - 16028628
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  16028681 tgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 16028628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 43574657 - 43574731
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||| |||||  ||  ||||||||||||||||||||||| |||||||||||||||| |||||||    
T  43574657 taaggctgcgtacaatataccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagagcaccgg 43574731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 130 - 208
Target Start/End: Complemental strand, 12477209 - 12477132
Alignment:
Q  130 aggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||||||||||||||||||||||| |||  |||||||||||||||||  |||| |||||  |||||||||||||||    
T  12477209 aggataaggctgcgtacaatacaccaa-aatggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacc 12477132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 1565388 - 1565562
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| |  ||||||||||| || |||||| ||||||| ||        |   |||||    
T  1565388 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgagtaaaaaaacatattaagg 1565487  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||| ||||||  ||   ||||||||||||||||||||||||||| |||||| |||||||||||| |||||    
T  1565488 ctgcgtacaatgcaccaa--atggcgggaccccttcccggaccctgcatatgtgggagc-ttagtgcaccgggttgcc 1565562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 16880731 - 16880657
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||||||||||||  ||  || |||| ||||||||||| ||| ||||||||||||||||||||||||    
T  16880731 taaggctgcgtacaatacaccaa--atggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccgg 16880657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 163 - 216
Target Start/End: Complemental strand, 30877621 - 30877568
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||||||| ||||||| ||||||||||| |||||    
T  30877621 tgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcc 30877568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 134 - 208
Target Start/End: Complemental strand, 7097844 - 7097772
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||| |||||||||||||||||  ||  || |||||||||||| ||||||| ||||||||||||||||||||||    
T  7097844 taaggttgcgtacaatacaccaa--atggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 7097772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 134 - 214
Target Start/End: Complemental strand, 42924918 - 42924836
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggac--cctgcatatgcgggagctttagtgcaccggattg 214  Q
    ||||| ||||||||||||||||| ||| |||| | |||||||| |||  ||||| ||||||| ||||||||||||||||||||    
T  42924918 taaggttgcgtacaatacaccaaaaatgatggaatcccttcccagacaccctgcgtatgcggaagctttagtgcaccggattg 42924836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 164 - 210
Target Start/End: Complemental strand, 10943900 - 10943855
Alignment:
Q  164 gggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||    
T  10943900 gggaccccttcccggaccctgca-atgcgggagctttagtgcaccgg 10943855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 12575739 - 12575670
Alignment:
Q  140 tgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||| |||  ||||||||||||| ||||||||| ||||| |||||||| |||||||||    
T  12575739 tgcgtacaatacaccaa-aatggtgggaccccttcctggaccctgcgtatgcaggagctttggtgcaccgg 12575670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 134 - 207
Target Start/End: Complemental strand, 19143027 - 19142956
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    |||||||||||||| ||||||||  ||  ||||||||||||||||||| ||| |||||||||| ||||||||||    
T  19143027 taaggctgcgtacagtacaccaa--atggtgggaccccttcccggaccatgcgtatgcgggagatttagtgcac 19142956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 132 - 206
Target Start/End: Original strand, 22187334 - 22187408
Alignment:
Q  132 gataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgca 206  Q
    |||||| |||||||||||||||||| ||  ||| |||||||||||  ||||| ||||||| ||||||||||||||    
T  22187334 gataagactgcgtacaatacaccaaaaacaatgagaccccttcccaaaccctacatatgcaggagctttagtgca 22187408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 140 - 216
Target Start/End: Original strand, 1405244 - 1405318
Alignment:
Q  140 tgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||  ||  |||||||| |||| | |||||||||||||||||||| |||| ||||||||||||    
T  1405244 tgcgtacaatacaccaa--atggtgggaccctttcctgaaccctgcatatgcgggagctctagtacaccggattgcc 1405318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 163 - 216
Target Start/End: Complemental strand, 22861726 - 22861673
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||| || |||||||||||||||||||| |||||||||| ||||||    
T  22861726 tgggaccccttctcgaaccctgcatatgcgggagctctagtgcaccgaattgcc 22861673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 39801594 - 39801647
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||| |||||| | |||||||||||||||||||||||| |||||    
T  39801594 tgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgcc 39801647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 201
Target Start/End: Complemental strand, 10306548 - 10306493
Alignment:
Q  145 acaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagcttta 201  Q
    |||||||||||| |||  ||||||||||||||||||||||| |||||||||||||||    
T  10306548 acaatacaccaa-aatggtgggaccccttcccggaccctgcgtatgcgggagcttta 10306493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 11657784 - 11657709
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||| ||||||||||||| |||  ||||||||||||||| |||||||| | |||||| ||||||| ||||||    
T  11657784 taaggctgcatacaatacaccaa-aatggtgggaccccttcccgaaccctgcacacgcgggaactttagttcaccgg 11657709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 29334446 - 29334521
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||||||||  |||  |||||||| |||||||||||||| |||| |||| ||||| ||||||||    
T  29334446 taaggctgcgtacaatacaccag-aatggtgggacccattcccggaccctgcgtatgtgggatctttaatgcaccgg 29334521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 33 - 121
Target Start/End: Complemental strand, 37024738 - 37024650
Alignment:
Q  33 tttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgt 121  Q
    ||||| ||||||||| || ||||| |||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||    
T  37024738 tttgaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt 37024650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 39 - 197
Target Start/End: Original strand, 2838735 - 2838890
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtga-tcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataag 137  Q
    ||||||||| ||||||||||||||| || ||||||||||| |  |||| | ||| | ||||||   ||||||||| ||||||||        ||| ||||    
T  2838735 gggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaaggtcacgaggtcaagtctcagaaacagcatcttgtgtaaaaac--agggtaag 2838832  T
Q  138 gctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagc 197  Q
    ||||||||||||||||||  |||  ||||| |||||| |||||||||| |||||||||||    
T  2838833 gctgcgtacaatacacca--aatggtgggatcccttctcggaccctgcgtatgcgggagc 2838890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 216
Target Start/End: Original strand, 32354211 - 32354258
Alignment:
Q  169 cccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||  |||||||||||||||||||||||| |||||    
T  32354211 cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcc 32354258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 163 - 209
Target Start/End: Complemental strand, 21784389 - 21784343
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    ||||||||||| ||||||||||| |||||||||| ||||||||||||    
T  21784389 tgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccg 21784343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 133 - 213
Target Start/End: Original strand, 1850689 - 1850767
Alignment:
Q  133 ataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggatt 213  Q
    |||||| ||||||||||||| |||  ||  ||||||| ||||| |||||||||  |||||| |||||||||||||||||||    
T  1850689 ataagggtgcgtacaatacatcaa--atggtgggaccacttcctggaccctgcggatgcggaagctttagtgcaccggatt 1850767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 3771390 - 3771464
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||| | |||||||||||||  |  |||||||||||||||||| |||  |||| |||||||||||||||||||    
T  3771390 taaggctgtgaacaatacaccaat--tggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgg 3771464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 4654472 - 4654427
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||| |||||| || ||||||||||||||||||||||||||||||    
T  4654472 tgggatcccttctcgaaccctgcatatgcgggagctttagtgcacc 4654427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 169 - 210
Target Start/End: Original strand, 13774949 - 13774990
Alignment:
Q  169 cccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||| ||||||||||| ||||||||||||||||||||||||    
T  13774949 ccctttccggaccctgcgtatgcgggagctttagtgcaccgg 13774990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 209012 - 208937
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||| | ||||||||||| |||  ||||||||||||| ||||||||  |||||  |||||||||||||||||    
T  209012 taaggctgcattcaatacaccaa-aatggtgggaccccttcctggaccctgggtatgcaagagctttagtgcaccgg 208937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 200
Target Start/End: Original strand, 22600505 - 22600569
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagcttt 200  Q
    |||||||| ||||||||||||||  ||  ||||| ||||||||||| ||||| ||||||||||||||    
T  22600505 taaggctgtgtacaatacaccaa--atggtgggatcccttcccggatcctgcgtatgcgggagcttt 22600569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 30006403 - 30006457
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    ||||||||||||||||  |||   |||||||||||||||||||||||| ||||||    
T  30006403 tgggaccccttcccggggcctatgtatgcgggagctttagtgcaccgggttgcct 30006457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 200
Target Start/End: Complemental strand, 24323762 - 24323725
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagcttt 200  Q
    |||||||||||||| ||||||| |||||||||||||||    
T  24323762 tgggaccccttcccagaccctgtatatgcgggagcttt 24323725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 200
Target Start/End: Complemental strand, 24360386 - 24360349
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagcttt 200  Q
    |||||||||||||| ||||||| |||||||||||||||    
T  24360386 tgggaccccttcccagaccctgtatatgcgggagcttt 24360349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 213
Target Start/End: Complemental strand, 9794462 - 9794385
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggatt 213  Q
    |||| |||| |||||||||||||  ||  ||||| |||||| | ||||| |||||||| | |||||||||||||||||||    
T  9794462 taagactgcatacaatacaccaa--atagtgggatcccttcacagacccagcatatgcagaagctttagtgcaccggatt 9794385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 210
Target Start/End: Original strand, 19093894 - 19093938
Alignment:
Q  166 gaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||| |||||||||||| ||||  ||||||||||||||||||    
T  19093894 gacccctacccggaccctgcgtatgttggagctttagtgcaccgg 19093938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 208
Target Start/End: Original strand, 19438757 - 19438789
Alignment:
Q  176 cggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||||||||||||||||||| |||||||||    
T  19438757 cggaccctgcatatgcgggagctctagtgcacc 19438789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 121
Target Start/End: Original strand, 23974732 - 23974819
Alignment:
Q  33 tttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgt 121  Q
    ||||| ||||||||| |||||||| |||||| || |||||||||||    ||| | |||||||||||| || |||||| ||||||||||    
T  23974732 tttgaggggtaaccttggcgcaac-ggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgt 23974819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 210
Target Start/End: Complemental strand, 24903750 - 24903706
Alignment:
Q  166 gaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||| ||||||| |||||| |||| |||||||||    
T  24903750 gaccccttcccggacactgcatacgcgggaactttggtgcaccgg 24903706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 208
Target Start/End: Complemental strand, 31694197 - 31694120
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    |||| ||| ||||| ||||||||||| ||  | ||||||| ||||||| |||| ||| |||||||||| |||||||||||    
T  31694197 taggctaaagctgcatacaatacacctat--tgatgggactccttcccagaccttgcgtatgcgggagatttagtgcacc 31694120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 207
Target Start/End: Complemental strand, 39079827 - 39079764
Alignment:
Q  143 gtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    |||||||||||||| |||  ||||||||||||||||||| ||  ||| |||||| ||||||||||    
T  39079827 gtacaatacaccaa-aatggtgggaccccttcccggaccatgtgtatacgggagttttagtgcac 39079764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 59)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 32 - 216
Target Start/End: Original strand, 14530268 - 14530451
Alignment:
Q  32 gtttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntag 131  Q
    |||||| ||||||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| || ||||||||||||||| |        ||    
T  14530268 gtttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaac-ag 14530366  T
Q  132 gataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    | ||||||| |||||||||||||||||||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  14530367 ggtaaggctacgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 14530451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 10543655 - 10543831
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| | |||| || |||||||||||   |||| | |||||||||||| || ||||| |||||||||||        ||| |||||    
T  10543655 gggtaaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacggcctcttgtgtaaaaaac-agggtaagg 10543753  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||| |||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  10543754 ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 10543831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 9671137 - 9671310
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtga-tcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataag 137  Q
    ||||||||| ||||||||||||||| || ||||||||||| |  |||  | |||||||||| | || |||||||||||||||||        ||| ||||    
T  9671137 gggtaaccttggcgcaaccggtaaagttgttgtcatgtgactggaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaac---agggtaag 9671233  T
Q  138 gctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||  ||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  9671234 gctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 9671310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 8455494 - 8455320
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||    ||| | |||||||||||| || |||||||||||||||||        ||| |||||    
T  8455494 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacac-agggtaagg 8455396  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  ||||||||||||||||||||||| ||||| |||||||||||||||||| |||||    
T  8455395 ctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgcc 8455320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 89 - 209
Target Start/End: Original strand, 5841035 - 5841154
Alignment:
Q  89 acgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcata 188  Q
    |||||||||||| ||||||||||||| ||||||       |||| ||||| ||||||||||||| |||||||  |||||||||||||||||||| |||||    
T  5841035 acgggttcaagtcctagaaacagccttttgtgtaaaaaa-tagggtaaggatgcgtacaatacatcaataatggtgggaccccttcccggaccccgcata 5841133  T
Q  189 tgcgggagctttagtgcaccg 209  Q
    |||||||||||||||||||||    
T  5841134 tgcgggagctttagtgcaccg 5841154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 21779437 - 21779265
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| ||| || || |||||||||||   |||| | |||||||||||| || || ||||||||||||||        ||| |||||    
T  21779437 gggtaaccttggcgcaactggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggagacagcctcttgtgtaaaac---agggtaagg 21779341  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
     |||||||||||||||||  ||  |||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  21779340 ttgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 21779265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 39 - 206
Target Start/End: Original strand, 17896216 - 17896381
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| | |||||| |||||| || ||||||||||| | |||| | |||| ||||||| ||||||||| ||||||||||       |||| |||||    
T  17896216 gggtaaccttgacgcaactggtaaagttgttgtcatgtgaccgaaaggtcacggattcaagtcctagaaacaacctcttgtgtaaaaaaatagggtaagg 17896315  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgca 206  Q
    |||||||||||| ||||  |||  |||||||||||| |||||||||| |||| |||||||||||||||    
T  17896316 ctgcgtacaatatacca--aatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgca 17896381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 23397723 - 23397895
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| || ||||| |||||| || |||||||||||   |||| | | |||||||||| || |||||||||||||||||       |||| |||||    
T  23397723 gggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaa---tagggtaagg 23397819  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    || |||||||||||||||  ||  |||||||||||| |||||||| |||||||||||||| ||||||||||| |||||    
T  23397820 ctacgtacaatacaccaa--atggtgggaccccttctcggaccctacatatgcgggagctctagtgcaccgggttgcc 23397895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 10546214 - 10546294
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  10546214 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 10546294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 11514393 - 11514566
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||    ||| | |||||||||| | || |||||||||||||||||        | | |||||    
T  11514393 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaactcctggaaacagcctcttgtgtaaaaaacaaag-taagg 11514491  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  |||||||| ||||| |||||||| ||||||||||||||||||||||||||||||    
T  11514492 ctgcgtacaatacaccaa--atggtgggaccc-ttcccagaccctgcgtatgcgggagctttagtgcaccggattgcc 11514566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 39 - 213
Target Start/End: Complemental strand, 19977892 - 19977721
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||| ||| ||| || || ||||||||||| | |||| | ||||||||||||||| ||||||||||||| |||       ||||||||||    
T  19977892 gggtaaccttggcggaactggtgaagttgttgtcatgtgaccgaaaggtcacgggttcaagttctggaaacagcctcttttgtaaaaaa-taggataagg 19977794  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggatt 213  Q
     |||||||||||||||||  ||  ||||| ||||||||| ||| ||  |||||||||||||||||||||| ||||    
T  19977793 ttgcgtacaatacaccaa--atggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgcaccagatt 19977721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 24200803 - 24200627
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtga-tcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataag 137  Q
    ||||||||| |  ||||| |||||| || ||||||||||| | ||||| | |||||||||||| || |||||||||||||||||        ||| ||||    
T  24200803 gggtaaccttgatgcaactggtaaagttgttgtcatgtgactgaaaag-tcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agggtaag 24200706  T
Q  138 gctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||| |||  ||||| ||||||||||||||||  |||| | ||||||||||||||||| |||||    
T  24200705 gctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgcc 24200627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 39 - 210
Target Start/End: Complemental strand, 12024096 - 12023929
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||        ||| |||||    
T  12024096 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaac--agggtaagg 12023999  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||||||  |||  ||||||||| ||||||||||||| |||  || ||||||| ||||||||    
T  12023998 ctgcgtacaatacacca--aatggtgggaccccctcccggaccctgcgtatttggaagctttaatgcaccgg 12023929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 34 - 216
Target Start/End: Complemental strand, 25079901 - 25079721
Alignment:
Q  34 ttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntagga 133  Q
    |||| ||||||||| |||||||| |||||| || |||||||||||    ||| | ||||||||||||  |||||||| ||||||||||        | |     
T  25079901 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttagaaacaacctcttgtgtaaaaaaacaagg 25079802  T
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||| ||||||||||||||| |  ||  ||||||||||||||||||||||| |||||  ||||||||||||||||| |||||    
T  25079801 taaggatgcgtacaatacaccga--atggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgcc 25079721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 35 - 216
Target Start/End: Complemental strand, 25249919 - 25249742
Alignment:
Q  35 tgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggat 134  Q
    ||||||||||||| |||||||  |||||| || |||||||||||    ||| | ||||||||||||  | ||||||| |||||||||        ||| |    
T  25249919 tgatgggtaaccttggcgcaattggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatggaaacagtctcttgtgtacaaac--agggt 25249822  T
Q  135 aaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||  ||  ||||| ||||||||| ||||||| |||||| ||||||||||||||||| |||||    
T  25249821 aaggctgcgtacaatacaccaa--atggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgcc 25249742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 89 - 208
Target Start/End: Original strand, 14444736 - 14444851
Alignment:
Q  89 acgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcata 188  Q
    |||||||||||| || |||||||||||||||||        ||| |||||||| |||| |||||||||  ||  ||||||||||||||||||||||| ||    
T  14444736 acgggttcaagtcctggaaacagcctcttgtgtaaaaac--agggtaaggctgtgtacgatacaccaa--atggtgggaccccttcccggaccctgcgta 14444831  T
Q  189 tgcgggagctttagtgcacc 208  Q
    ||||||||||||||||||||    
T  14444832 tgcgggagctttagtgcacc 14444851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 36871543 - 36871622
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  ||||||||||||||||||| ||| |||||||||||||||||||||||| |||||    
T  36871543 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggacc-tgcgtatgcgggagctttagtgcaccgggttgcc 36871622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 104 - 211
Target Start/End: Original strand, 17471570 - 17471676
Alignment:
Q  104 agaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagt 203  Q
    ||||||||||||||||||        |||||||| |||||||||||| ||||| ||| ||| ||||||||||| |||||||| |||||||||| ||||||    
T  17471570 agaaacagcctcttgtgtaaaaaaacaggataagactgcgtacaatataccaa-aatgatgagaccccttccctgaccctgcctatgcgggagttttagt 17471668  T
Q  204 gcaccgga 211  Q
    ||||||||    
T  17471669 gcaccgga 17471676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 136 - 217
Target Start/End: Complemental strand, 24860070 - 24859991
Alignment:
Q  136 aggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    |||||||||||||||||||||  ||  | | |||||||| |||||||||| |||||||||||||||||||||||||||||||    
T  24860070 aggctgcgtacaatacaccaa--atggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcaccggattgcct 24859991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 34080179 - 34080232
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||| |||||    
T  34080179 tgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgcc 34080232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 41409940 - 41409993
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||| |||||    
T  41409940 tgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgcc 41409993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 139 - 215
Target Start/End: Original strand, 23488537 - 23488613
Alignment:
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgc 215  Q
    |||||| |||||||| || |||  ||||||||||||||||||||||| |||||| ||||||||||||||||| ||||    
T  23488537 ctgcgtgcaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgc 23488613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 134 - 207
Target Start/End: Original strand, 24890462 - 24890533
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    ||||||||| ||||||||||||||  |  ||||||||||||||||||||||| ||||| |||||||||||||||    
T  24890462 taaggctgcatacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac 24890533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 130 - 208
Target Start/End: Complemental strand, 44449472 - 44449395
Alignment:
Q  130 aggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||||||||||||||||||||||| |||  ||||||||||||||||||||||| | || ||||| |||| ||||||    
T  44449472 aggataaggctgcgtacaatacaccaa-aatagtgggaccccttcccggaccctgcgtttgtgggagttttaatgcacc 44449395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 163 - 216
Target Start/End: Complemental strand, 40579806 - 40579753
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||| |||||    
T  40579806 tgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgcc 40579753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 94 - 210
Target Start/End: Complemental strand, 4516474 - 4516361
Alignment:
Q  94 ttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgg 193  Q
    ||||||||||||||||||||||||||||        |||  || ||||||||||||||||||||  |  ||||||||||||||||||||||| |||| ||    
T  4516474 ttcaagttctagaaacagcctcttgtgtaaaaaac-agggcaacgctgcgtacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgtgg 4516378  T
Q  194 gagctttagtgcaccgg 210  Q
     |||||||||| |||||    
T  4516377 aagctttagtgtaccgg 4516361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 39 - 208
Target Start/End: Original strand, 14544020 - 14544189
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||  |||||| || |||||||||||   |||| |||| ||| || || || |||||||||||||||||        ||| ||||     
T  14544020 gggtaaccttggcgcaattggtaaagttgttgtcatgtgactgaaaggttacaggtccaggtactggaaacagcctcttgtgtagaaaaacagggtaaga 14544119  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    |||||| |||||  | || |||  | ||||||||||| ||||||||| ||||||||||||||||||||||    
T  14544120 ctgcgtgcaataaccaaaaaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcacc 14544189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 166 - 209
Target Start/End: Complemental strand, 3633762 - 3633719
Alignment:
Q  166 gaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    ||||||||||||||||| ||||||||||||||||||||||||||    
T  3633762 gaccccttcccggaccccgcatatgcgggagctttagtgcaccg 3633719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 130 - 216
Target Start/End: Original strand, 25632556 - 25632640
Alignment:
Q  130 aggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||||||  |||  |||||  |||||||| ||| | | |||||||||||||||||||||||| |||||    
T  25632556 aggataaggctgcgtacaatacacca--aatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgcc 25632640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 163 - 206
Target Start/End: Original strand, 34766333 - 34766376
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgca 206  Q
    ||||||||||||||||||||||| ||||||||||||||||||||    
T  34766333 tgggaccccttcccggaccctgcgtatgcgggagctttagtgca 34766376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 40762318 - 40762238
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||| |||||||||||||||  ||  |||||||| |||| ||||||||| |||| ||||||||||||||||||| |||||    
T  40762318 taaggctacgtacaatacaccaa--atggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcaccgggttgcc 40762238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 1289100 - 1289154
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagc-tttagtgcaccggattgcc 216  Q
    ||||||||||||||||| | ||||||||||||||| |||||||||||||||||||    
T  1289100 tgggaccccttcccggatcatgcatatgcgggagcttttagtgcaccggattgcc 1289154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 134 - 208
Target Start/End: Original strand, 19615043 - 19615116
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    |||| |||||||||||| |||||||||  ||| ||||||||||| ||||||| ||||| ||||||||||||||||    
T  19615043 taagactgcgtacaatataccaataatagtgg-accccttcccgaaccctgcgtatgcaggagctttagtgcacc 19615116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 144 - 214
Target Start/End: Complemental strand, 31158515 - 31158445
Alignment:
Q  144 tacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattg 214  Q
    ||||||| ||||| |||  |||||||||||||| |||||||| ||||||||||||||||| |||| |||||    
T  31158515 tacaataaaccaaaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtacacctgattg 31158445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 162 - 216
Target Start/End: Original strand, 31525783 - 31525837
Alignment:
Q  162 atgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||| || || ||||||||||||||||||||||||||| |||||||||||    
T  31525783 atgggaccctttgccagaccctgcatatgcgggagctttagtgtaccggattgcc 31525837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 135 - 216
Target Start/End: Complemental strand, 40416954 - 40416875
Alignment:
Q  135 aaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||| |||||||||||||||  | ||||||||| ||   |||||||||||||||| ||||||||||||||||| |||||    
T  40416954 aaggctgtgtacaatacaccaat--tgatgggacccttttttggaccctgcatatgcgagagctttagtgcaccgggttgcc 40416875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 172 - 217
Target Start/End: Complemental strand, 124962 - 124917
Alignment:
Q  172 ttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    |||||||||||||| |||||||||||||||||||||||| ||||||    
T  124962 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcct 124917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 4794879 - 4794924
Alignment:
Q  162 atgggaccccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    |||||||||||||||||| |||||||||||||||||| ||||||||    
T  4794879 atgggaccccttcccggatcctgcatatgcgggagctctagtgcac 4794924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 134 - 214
Target Start/End: Complemental strand, 26684704 - 26684626
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattg 214  Q
    ||||||||||||||||| || ||  ||  ||||||| ||||||| ||||||| ||||||||||||||| ||||||||||||    
T  26684704 taaggctgcgtacaatatactaa--atggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccggattg 26684626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 44643574 - 44643648
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||  |||||  ||  |||||||||||||| |||||||| ||||||||||| ||||||||||||    
T  44643574 taaggctgcgtacaatgtaccaa--atggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgg 44643648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 172 - 216
Target Start/End: Original strand, 22371199 - 22371243
Alignment:
Q  172 ttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||| |||||||||||||||||||||||| |||||    
T  22371199 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 22371243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 217
Target Start/End: Complemental strand, 39189555 - 39189507
Alignment:
Q  169 cccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    |||||||||||||| ||||||||||||||| ||||||||||| ||||||    
T  39189555 cccttcccggaccccgcatatgcgggagctctagtgcaccgggttgcct 39189507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 208
Target Start/End: Original strand, 8575975 - 8576018
Alignment:
Q  165 ggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||||||||||||||||| |||| |||||||||||||||||    
T  8575975 ggaccccttcccggaccctgcgtatgtgggagctttagtgcacc 8576018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 134 - 204
Target Start/End: Complemental strand, 13245179 - 13245111
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtg 204  Q
    |||||||||||||| ||||| ||  ||  ||||||||||||||||||| ||||||| ||||||||||||||    
T  13245179 taaggctgcgtacattacactaa--atggtgggaccccttcccggaccatgcatatacgggagctttagtg 13245111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 17668053 - 17668133
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  ||| |||||||| || ||||||| |||  ||||||||||||||||||| |||||    
T  17668053 taaggctgcgtacaatacaccaa--atggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgcc 17668133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 214
Target Start/End: Original strand, 25641558 - 25641630
Alignment:
Q  140 tgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattg 214  Q
    |||||||||||||||||  ||  ||||||||||||||| | ||||| |||||| ||||||||||| |||||||||    
T  25641558 tgcgtacaatacaccaa--attgtgggaccccttcccgaatcctgcgtatgcgagagctttagtgaaccggattg 25641630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 129 - 214
Target Start/End: Original strand, 30826082 - 30826164
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattg 214  Q
    |||| ||||| |||||||||||||||||  ||  ||| |||| ||||| |||||| |||||||||||||||||||||||| |||||    
T  30826082 tagggtaaggttgcgtacaatacaccaa--atggtggaaccc-ttcccagaccctacatatgcgggagctttagtgcaccagattg 30826164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 209
Target Start/End: Complemental strand, 21377233 - 21377085
Alignment:
Q  57 cggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaa 156  Q
    ||||||| || |||||||||||   |||| ||||| ||||||||  |||||||| ||||||||||        ||| |||||||| ||||||| ||||||    
T  21377233 cggtaaagttgttgtcatgtgactgaaaggttacgagttcaagtcatagaaacatcctcttgtgtaaaaaac-agggtaaggctgggtacaatgcaccaa 21377135  T
Q  157 taatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
      ||  ||||||||||||||| ||||||| |||| ||||||||| ||||||||    
T  21377134 --atggtgggaccccttcccgaaccctgcgtatgtgggagcttt-gtgcaccg 21377085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 217
Target Start/End: Original strand, 7214585 - 7214668
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    |||||||||||||||||||| || |||  || || |||||| ||||| |||| |||||| ||| ||||||||||| | ||||||    
T  7214585 taaggctgcgtacaatacacaaaaaatggtgagatcccttctcggacactgcgtatgcgagagttttagtgcaccaggttgcct 7214668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 17623615 - 17623695
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||  |||  ||| ||||||||||| | ||||| |||| || ||||||||||||| || |||||    
T  17623615 taaggctgcgtacaatacacca--aatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcactgggttgcc 17623695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 203
Target Start/End: Complemental strand, 19185823 - 19185760
Alignment:
Q  140 tgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagt 203  Q
    |||||||||| ||| || |||  ||| ||||||||| ||||||||| |||||||||||||||||    
T  19185823 tgcgtacaatgcacaaaaaatggtggaaccccttcctggaccctgcgtatgcgggagctttagt 19185760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 184
Target Start/End: Original strand, 22371105 - 22371153
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctg 184  Q
    ||||||||||||||||||||||  |||  ||||||||||||||||||||||    
T  22371105 taaggctgcgtacaatacacca--aatggtgggaccccttcccggaccctg 22371153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 200
Target Start/End: Complemental strand, 32781372 - 32781308
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagcttt 200  Q
    |||| ||||||||||||||||||  ||  |||||||||||||| |||||||  ||||||||||||||    
T  32781372 taagactgcgtacaatacaccaa--atggtgggaccccttcccagaccctgtgtatgcgggagcttt 32781308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 135 - 204
Target Start/End: Complemental strand, 99348 - 99281
Alignment:
Q  135 aaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtg 204  Q
    ||||||||||||||||||||||  ||  ||| |||||||| | |||||||  ||||||||||||||||||    
T  99348 aaggctgcgtacaatacaccaa--atggtggaaccccttctcagaccctgtgtatgcgggagctttagtg 99281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 121
Target Start/End: Original strand, 17705452 - 17705534
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgt 121  Q
    ||||||||| || ||||| |||||| || |||||||||||  | ||| | |||||||||||| || ||||| |||||||||||    
T  17705452 gggtaaccttggtgcaactggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaaccgcctcttgtgt 17705534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 24059053 - 24059012
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtg 204  Q
    ||||||||||| ||||||||||| |||| |||||||||||||    
T  24059053 tgggacccctttccggaccctgcgtatgtgggagctttagtg 24059012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 216
Target Start/End: Complemental strand, 39914362 - 39914310
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||| | ||||||| |||||||||||||||||||| ||| |||||    
T  39914362 tgggaccccttcctg-accctgcgtatgcgggagctttagtgcatcgggttgcc 39914310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 207
Target Start/End: Original strand, 31523325 - 31523353
Alignment:
Q  179 accctgcatatgcgggagctttagtgcac 207  Q
    |||||||||||||||||||||||||||||    
T  31523325 accctgcatatgcgggagctttagtgcac 31523353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 208
Target Start/End: Complemental strand, 31821432 - 31821355
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    |||| ||||| || ||||||||||||||  || |||||||||||| ||| | ||||  ||||||||||||||| ||||||    
T  31821432 tagggtaaggttgtgtacaatacaccaa--atgatgggacccctttccgaaacctgtgtatgcgggagctttaatgcacc 31821355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 36)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 29356036 - 29355859
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaa-ttattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataag 137  Q
    ||||||||| ||| |||| ||||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||        ||| ||||    
T  29356036 gggtaaccttggcacaactggtaaaaattgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaac-agggtaag 29355938  T
Q  138 gctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  29355937 gctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 29355859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 1346921 - 1347093
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| || ||||||||| |||||||        ||| |||||    
T  1346921 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagccacttgtgtaaaac---agggtaagg 1347017  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  |||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  1347018 ctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 1347093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 1354933 - 1354761
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | || ||||||||| || |||||||||||||||||        ||| |||||    
T  1354933 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcactggttcaagtcctggaaacagcctcttgtgtaaaac---agggtaagg 1354837  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  |||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  1354836 ctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 1354761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 49 - 216
Target Start/End: Complemental strand, 12222085 - 12221918
Alignment:
Q  49 ggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaa 148  Q
    |||||||| |||||| || |||||||||||   |||| | ||||||||||||  | |||||||||||||||||        ||| |||||||||||||||    
T  12222085 ggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaac-agggtaaggctgcgtacaa 12221987  T
Q  149 tacaccaataatcatgggaccccttcccggaccctgcatatgcgggagc-tttagtgcaccggattgcc 216  Q
    ||||||||||||  ||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||    
T  12221986 tacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgcc 12221918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 130 - 216
Target Start/End: Complemental strand, 2166500 - 2166414
Alignment:
Q  130 aggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||| |||||||||||||||||||||  |||||||||||||||||||||  |||| |||||||||||||||||||| |||||    
T  2166500 aggataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgcc 2166414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 130 - 216
Target Start/End: Complemental strand, 2178133 - 2178047
Alignment:
Q  130 aggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||| |||||||||||||||||||||  |||||||||||||||||||||  |||| |||||||||||||||||||| |||||    
T  2178133 aggataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgcc 2178047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 39 - 208
Target Start/End: Original strand, 9161080 - 9161247
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| | ||||| ||||||| || |||||||||||   |||| | || ||||||||| || |||||||||||||||||        ||  |||||    
T  9161080 gggtaaccttgacgcaatcggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacagag--taagg 9161177  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    |||||||||||||| |||||||  |||||||||||| |||||||||| ||||||| ||||||||||||||    
T  9161178 ctgcgtacaatacatcaataatggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcacc 9161247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 140 - 216
Target Start/End: Original strand, 12892064 - 12892140
Alignment:
Q  140 tgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||| ||||||||||||||  |||||||||||||||||||| ||||||||||||||||||||||||||| |||||    
T  12892064 tgcgtataatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc 12892140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 26097209 - 26097289
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  || | ||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  26097209 taaggctgcgtacaatacaccaa--atgaagggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 26097289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 25557774 - 25557854
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  || | || |||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  25557774 taaggctgcgtacaatacaccaa--atgaaggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 25557854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 146 - 216
Target Start/End: Complemental strand, 14975164 - 14975094
Alignment:
Q  146 caatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||  ||||||||||||||| |||| ||||||||||||| ||||||||||||| |||||    
T  14975164 caatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccgggttgcc 14975094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 139 - 216
Target Start/End: Complemental strand, 3116210 - 3116133
Alignment:
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||| |||||||||||| |||  |||||||||||| |||||| ||| ||||||||||||||||| ||||||||||||    
T  3116210 ctgcgcacaatacaccaaaaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgcc 3116133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 139 - 216
Target Start/End: Original strand, 12885967 - 12886044
Alignment:
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||| || |||  |||||||||||||| |||||||| |||| ||||||||||||||||||| |||||    
T  12885967 ctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgcc 12886044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 6808473 - 6808526
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||| |||||    
T  6808473 tgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcc 6808526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 207
Target Start/End: Complemental strand, 7947456 - 7947384
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    ||||||||||||||||||||||| |||  |||| |||||||||||||| ||| |||| ||||||||||||||||    
T  7947456 taaggctgcgtacaatacaccaa-aatggtgggcccccttcccggaccttgcgtatgtgggagctttagtgcac 7947384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 51 - 188
Target Start/End: Original strand, 6024202 - 6024338
Alignment:
Q  51 cgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaata 150  Q
    |||||| |||||| || ||||||||||||   ||| | |||| ||||| | ||||||||||||||||||||         || |||| ||||||||||||    
T  6024202 cgcaactggtaaagttgttgtcatgtgattggaaggtcacggtttcaaatcctagaaacagcctcttgtgtaaaaaacatgg-taagactgcgtacaata 6024300  T
Q  151 caccaataatcatgggaccccttcccggaccctgcata 188  Q
    |||||||||| |||||||| |||||||||||| |||||    
T  6024301 caccaataatgatgggacctcttcccggaccccgcata 6024338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 163 - 209
Target Start/End: Complemental strand, 23930184 - 23930138
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    |||||||||||| |||||||||| |||||||||||||||||||||||    
T  23930184 tgggaccccttcacggaccctgcttatgcgggagctttagtgcaccg 23930138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 134 - 203
Target Start/End: Original strand, 32579476 - 32579543
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagt 203  Q
    |||| ||||||||||||| ||||  ||  |||||||||||||| ||||||||||||||||||||||||||    
T  32579476 taagcctgcgtacaataccccaa--atggtgggaccccttcccagaccctgcatatgcgggagctttagt 32579543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 13267803 - 13267856
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||| ||||||||| ||||||||||||| |||||||||| |||||    
T  13267803 tgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcc 13267856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 129 - 210
Target Start/End: Complemental strand, 2755513 - 2755430
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatat--gcgggagctttagtgcaccgg 210  Q
    |||| ||||||||||||||||||||||| |||  |||||  |||||||  | |||||||||  |||||||||||||||||||||    
T  2755513 taggctaaggctgcgtacaatacaccaaaaatggtgggagtccttcccaaatcctgcatatgcgcgggagctttagtgcaccgg 2755430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 163 - 210
Target Start/End: Complemental strand, 10734962 - 10734915
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||| |||||||||||||||||| ||||||||||||||||| ||||||    
T  10734962 tgggcccccttcccggaccctgcgtatgcgggagctttagtccaccgg 10734915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 11395839 - 11395886
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||| ||||| ||||||||||||||||| ||||||    
T  11395839 tgggaccccttcccggatcctgcgtatgcgggagctttagtccaccgg 11395886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 39 - 210
Target Start/End: Complemental strand, 3815255 - 3815087
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||  | |||||||||||| || ||||||| || ||||||       || | || |     
T  3815255 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcctggaaacagactattgtgtaaaaaa-tatggtacga 3815157  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||||  ||  |||||||| |||||| ||||| | ||||||| ||||||||||||||||    
T  3815156 ctgcgtacaatacaccaa--atggtgggaccctttcccgaaccctacgtatgcggaagctttagtgcaccgg 3815087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 217
Target Start/End: Complemental strand, 30786427 - 30786377
Alignment:
Q  167 accccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    ||||||||| ||||| ||| |||||||||||||||||||||||| ||||||    
T  30786427 accccttcctggaccgtgcgtatgcgggagctttagtgcaccgggttgcct 30786377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 206
Target Start/End: Original strand, 19340889 - 19340949
Alignment:
Q  145 acaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgca 206  Q
    |||||||||||| ||| |||||||||||||| |||||| || ||||||| ||||||||||||    
T  19340889 acaatacaccaa-aatgatgggaccccttcctggacccggcgtatgcggaagctttagtgca 19340949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 24097655 - 24097696
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtg 204  Q
    ||||||||||||||||||||||| ||||||| ||||||||||    
T  24097655 tgggaccccttcccggaccctgcgtatgcggaagctttagtg 24097696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 141 - 216
Target Start/End: Complemental strand, 383837 - 383764
Alignment:
Q  141 gcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||  ||  |||||||||||| | |||||||| ||||||||||||| ||| |||||| |||||    
T  383837 gcgtacaatacaccaa--attgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgcc 383764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 121
Target Start/End: Complemental strand, 14975255 - 14975176
Alignment:
Q  42 taacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgt 121  Q
    |||||| ||||||||||||||| || |||||||||||    ||| | |||| ||||||| || |||||||||||||||||    
T  14975255 taaccttggcgcaaccggtaaagttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcctcttgtgt 14975176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 20906841 - 20906802
Alignment:
Q  165 ggaccccttcccggaccctgcatatgcgggagctttagtg 204  Q
    |||||||||||| ||||| |||||||||||||||||||||    
T  20906841 ggaccccttcccagaccccgcatatgcgggagctttagtg 20906802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 17432397 - 17432479
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||| ||||||||||| || |||  || ||||  |||||||| ||||   ||||||||||||||||||||||| |||||    
T  17432397 taaggctgtgtacaatacactaaaaatggtgagaccttttcccggatcctgtgcatgcgggagctttagtgcaccgggttgcc 17432479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 136 - 213
Target Start/End: Original strand, 28007679 - 28007753
Alignment:
Q  136 aggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggatt 213  Q
    ||||||||||||||||||||  |||  ||||||||||||||  | ||| ||||||||| |||| ||||||||||||||    
T  28007679 aggctgcgtacaatacacca--aatgctgggaccccttccc-taacctccatatgcggaagctctagtgcaccggatt 28007753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 207
Target Start/End: Complemental strand, 15866096 - 15866052
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    ||||||||||||||||||||||| | ||||||| || ||||||||    
T  15866096 tgggaccccttcccggaccctgcgtttgcgggatctatagtgcac 15866052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 202
Target Start/End: Original strand, 24734693 - 24734760
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttag 202  Q
    ||||| ||||||||||||| ||| ||   ||||||||||||||||| ||||| ||||| ||||||||||    
T  24734693 taaggttgcgtacaatacaacaaaaaaggtgggaccccttcccggatcctgcgtatgc-ggagctttag 24734760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 201
Target Start/End: Complemental strand, 29016337 - 29016301
Alignment:
Q  165 ggaccccttcccggaccctgcatatgcgggagcttta 201  Q
    |||||||||||| |||||||| |||||||||||||||    
T  29016337 ggaccccttcccagaccctgcgtatgcgggagcttta 29016301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 209
Target Start/End: Original strand, 33138884 - 33138957
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    |||||| ||||||||||||||||  ||  |||||||| || ||||||||||  ||||| | |||||||||||||||    
T  33138884 taaggccgcgtacaatacaccaa--atggtgggacccttttccggaccctgtgtatgcagtagctttagtgcaccg 33138957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 33922910 - 33922870
Alignment:
Q  167 accccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    ||||||||||||||||||| ||||  |||||||||||||||    
T  33922910 accccttcccggaccctgcttatgttggagctttagtgcac 33922870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 60)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 13628971 - 13628794
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaa-ttattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataag 137  Q
    ||||||||| ||| |||| ||||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||        ||| ||||    
T  13628971 gggtaaccttggcacaactggtaaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaac-agggtaag 13628873  T
Q  138 gctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  13628872 gctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 13628794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 46421215 - 46421038
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||        ||| |||||    
T  46421215 gggtaaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agggtaagg 46421117  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagcttt-agtgcaccggattgcc 216  Q
    ||||||||||||||||||||||  ||||||||||||||||||||||| |||||||||||||| |||||||||| |||||    
T  46421116 ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggtttgcc 46421038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 13730782 - 13730606
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||    ||| | |||||||||||| || |||||||||||||||||        ||| |||||    
T  13730782 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agggtaagg 13730684  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||| ||||||||||||||||||  |||||||||||||||||||| ||||||||||||||||||||||||||| |||||    
T  13730683 ctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc 13730606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 29366900 - 29366724
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||| ||| |||||| || |||||||||||  ||||| | |||||||||||| || ||||||||||||||| |        ||| |||||    
T  29366900 gggtaaccttggcgtaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaac-agggtaagg 29366802  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||  ||||||||||||||||||||||| |||| |||||||||||||||| || |||||    
T  29366801 ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgcc 29366724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 353435 - 353353
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||||||  |||||||||||||||||||| ||||||||||||||||||||||||||| |||||    
T  353435 taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc 353353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 39 - 201
Target Start/End: Complemental strand, 8247867 - 8247706
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||        ||| |||||    
T  8247867 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agggtaagg 8247769  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagcttta 201  Q
     |||||||||||||||||||||  |||||| |||||||||||||||| |||||||||||||||    
T  8247768 ttgcgtacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagcttta 8247706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 49013559 - 49013477
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||||||  |||||||||||||||||||| ||||| ||||||||||||||||||||| |||||    
T  49013559 taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtgcaccgggttgcc 49013477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 1217069 - 1217241
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || | ||||||| |   |||| | |||||||||||| || |||||||||||||||||        ||| |||||    
T  1217069 gggtaaccttggcgcaactggtaaagttgtagtcatgtcactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac---agggtaagg 1217165  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||   ||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  1217166 ctgcgtacaatacaccaa--atggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 1217241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 92 - 210
Target Start/End: Original strand, 14986989 - 14987106
Alignment:
Q  92 ggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgc 191  Q
    ||||||||| || |||||||||||||||||        ||| |||||||||||||||||||||||||||  |||||||| |||||||||| |||||||||    
T  14986989 ggttcaagtcctggaaacagcctcttgtgtaaaaaac-agggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgc 14987087  T
Q  192 gggagctttagtgcaccgg 210  Q
    |||||||||||||||||||    
T  14987088 gggagctttagtgcaccgg 14987106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 40272990 - 40272816
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||    ||| | | |||||||||| || |||||| ||||||||||        ||| |||||    
T  40272990 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaac-agggtaagg 40272892  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  40272891 ctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 40272816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 39203495 - 39203667
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| ||| ||||  ||||| || |||||||||||   |||| | || ||||||||| || |||||||||||||||||        ||| |||||    
T  39203495 gggtaaccttggcacaacttgtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtccttgaaacagcctcttgtgtaaaac---agggtaagg 39203591  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
     |||||||||||||||||  ||  ||||||||||||||||||| |||||||||||||||||||||||||||| |||||    
T  39203592 ttgcgtacaatacaccaa--atggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgcc 39203667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 40 - 216
Target Start/End: Complemental strand, 22123092 - 22122921
Alignment:
Q  40 ggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggc 139  Q
    |||||||| ||||| || |||||| || |||||||||||   |||| |  ||||||||||| || ||||||| |||||||||        ||| ||||||    
T  22123092 ggtaaccttggcgccactggtaaatttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacagtctcttgtgtaaaac---agggtaaggc 22122996  T
Q  140 tgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||  ||  |||||||||||||||||||||||||||||| ||||| ||||||||||| |||||    
T  22122995 tgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgcc 22122921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 88 - 216
Target Start/End: Original strand, 31592877 - 31593000
Alignment:
Q  88 tacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcat 187  Q
    ||||||||||||| || |||||||||||||||||        ||| |||||||||||||||||||||||  ||  |||||| ||||||||||||||||||    
T  31592877 tacgggttcaagtcctggaaacagcctcttgtgtaaaac---agggtaaggctgcgtacaatacaccaa--atggtgggactccttcccggaccctgcat 31592971  T
Q  188 atgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||| ||||||||||| |||||    
T  31592972 atgcgggagctctagtgcaccgggttgcc 31593000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 54484764 - 54484844
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  54484764 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 54484844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 89 - 208
Target Start/End: Complemental strand, 10795553 - 10795435
Alignment:
Q  89 acgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcata 188  Q
    |||||||||||| || |||||||||||||||||        ||| ||||||||||||||||||||||| |||  ||||||||||||| ||||||||| ||    
T  10795553 acgggttcaagtcctggaaacagcctcttgtgtaaaagac-agggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgta 10795455  T
Q  189 tgcgggagctttagtgcacc 208  Q
    ||||||||||| ||||||||    
T  10795454 tgcgggagcttcagtgcacc 10795435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 34 - 216
Target Start/End: Original strand, 22609741 - 22609918
Alignment:
Q  34 ttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntagga 133  Q
    |||| ||||||||| |||||||| |||||| || |||||||||||    ||| | ||||||||||||  | |||||||||||||||||        |||     
T  22609741 ttgaggggtaaccttggcgcaac-ggtaaagttgttgtcatgtgactgtaaggtaacgggttcaagtcttggaaacagcctcttgtgtaaaaac--aggg 22609837  T
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  ||||||||||||||||||| ||| ||||||||||||| |||||||||| |||||    
T  22609838 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgcc 22609918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 45786300 - 45786218
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||| |||  |||||||||||||||||||||||  |||| |||||||||||||||||| |||||    
T  45786300 taaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgcaccgggttgcc 45786218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 52926388 - 52926223
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||    ||| | |||||||||||| || |||||||||||||||||        ||  |||||    
T  52926388 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgt--------ag--taagg 52926299  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  |||||| |||||||||||||||| |||||||||||||||| ||||||| |||||    
T  52926298 ctgcgtacaatacaccaa--atggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgcc 52926223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 34771448 - 34771374
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||||||||||||  ||  |||||||||||||||||||||||||||||||||||| |||||||||||    
T  34771448 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg 34771374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 34 - 210
Target Start/End: Complemental strand, 7697068 - 7696902
Alignment:
Q  34 ttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntagga 133  Q
    |||| ||||||||| |||||||| |||||| || |||||||||||  ||||| | |||||||||||| || ||||||| |||||||||        |||     
T  7697068 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaac---aggg 7696972  T
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||||||||||||     ||||  ||||||||||||| ||||||||| ||||||| |||||||||||    
T  7696971 taaggctgcgtacaatacaccaa-----atgg--ccccttcccggacactgcatatgtgggagctctagtgcaccgg 7696902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 39 - 203
Target Start/End: Original strand, 9607182 - 9607345
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| ||||||||  ||||| || |||||||||||   |||| | |  ||||||||| || |||||||||||||| ||        ||| |||||    
T  9607182 gggtaaccttggcgcaacttgtaaagttgttgtcatgtgactgaaaggtcatcggttcaagtcctggaaacagcctcttgcgtaaaaaac-agggtaagg 9607280  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagt 203  Q
    ||||||| ||||||||||||||  |||||||||||||| ||||| ||||||||||||||||||||    
T  9607281 ctgcgtagaatacaccaataatgttgggaccccttcccagaccccgcatatgcgggagctttagt 9607345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 15797293 - 15797373
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  |||||||||||||||||||||||||||| ||||||| ||||||||||| |||||    
T  15797293 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcc 15797373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 129 - 208
Target Start/End: Complemental strand, 54374435 - 54374357
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    |||| |||||||||||||||| |||||| |||  ||||||||||||||||||||||||||||||||||||||||| ||||    
T  54374435 tagggtaaggctgcgtacaatccaccaa-aatggtgggaccccttcccggaccctgcatatgcgggagctttagttcacc 54374357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 12914213 - 12914039
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||| |||||| | |||| | ||  |||||||| || |||||||||||||||||        ||| |||||    
T  12914213 gggtaaccttggcgcaactggtaaagttgttgtaatgtgaccgaaaggtcacaagttcaagtcctggaaacagcctcttgtgtaaaaaac-agggtaagg 12914115  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    | ||||||||||||||||  ||  || ||||||||||| |||||||||||||||||||||| | |||||||| |||||    
T  12914114 cggcgtacaatacaccaa--atggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttgcc 12914039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 47 - 216
Target Start/End: Original strand, 26869694 - 26869859
Alignment:
Q  47 tcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtac 146  Q
    |||||||||| |||||| || |||||||||||   |||| | || ||||||||| || |||||||||||| ||||        ||| |||||||||||||    
T  26869694 tcggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctctggtgtaaaaac--agggtaaggctgcgtac 26869791  T
Q  147 aatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||  ||  ||||||||||| ||||||| ||| |||||||||||||| ||||||||| |||||    
T  26869792 aatacaccaa--atggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgcc 26869859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 33 - 216
Target Start/End: Complemental strand, 5173905 - 5173723
Alignment:
Q  33 tttgatgggtaacctcggcgcaaccggtaaaa-ttattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntag 131  Q
    ||||| ||||||||| ||||||||  |||||| || |||||||||||   |||| | |||||||||||| || |||||| ||||||||||        ||    
T  5173905 tttgaggggtaaccttggcgcaactcgtaaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaacaaag 5173806  T
Q  132 gataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
      ||||| ||| | ||||||||||| |||  |||| |||||||||||||| ||| |||||||||||||||||||||||| |||||    
T  5173805 --taaggttgcatgcaatacaccaaaaatggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgcc 5173723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 134 - 209
Target Start/End: Complemental strand, 6411906 - 6411833
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    |||||||||||||||||||||||  || ||||||||||||||| |||| ||| |||||||||||||||||||||||    
T  6411906 taaggctgcgtacaatacaccaa--atgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcaccg 6411833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 129 - 210
Target Start/End: Complemental strand, 45948927 - 45948848
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||| ||||||||| ||||||||||||||  |  |||||||||||| |||||||||| ||||||||||||||||||||||||    
T  45948927 tagggtaaggctgcatacaatacaccaat--tggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgg 45948848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 163 - 216
Target Start/End: Complemental strand, 24851358 - 24851305
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||| |||||    
T  24851358 tgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgcc 24851305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 30452895 - 30452948
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  30452895 tgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 30452948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 89 - 207
Target Start/End: Complemental strand, 34420772 - 34420656
Alignment:
Q  89 acgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcata 188  Q
    |||||||||||| || |||||||||||||||||        ||| ||||||||||||| ||||||||| |||  ||||||||||||||||||| ||| ||    
T  34420772 acgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agggtaaggctgcgtaccatacaccaa-aatggtgggaccccttcccggaccttgcgta 34420675  T
Q  189 tgcgggagctttagtgcac 207  Q
    || ||||||||||||||||    
T  34420674 tgtgggagctttagtgcac 34420656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 68 - 216
Target Start/End: Original strand, 516417 - 516565
Alignment:
Q  68 ttgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataa-tcatggg 166  Q
    |||||||||||   |||| | |||||||||||| || |||||||||||||||||        ||| |||||||||| |||||| ||||| || |   |||    
T  516417 ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agggtaaggctgcgcacaataaaccaaaaaatggcggg 516515  T
Q  167 accccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||| |||||||| |||||||||||||||||||||||| |||||    
T  516516 accccttccccgaccctgcgtatgcgggagctttagtgcaccgggttgcc 516565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 216
Target Start/End: Original strand, 16735415 - 16735593
Alignment:
Q  34 ttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntagga 133  Q
    |||| ||||||||| |||||||| |||||| || |||||||||||    ||  | |||||||||||| || |||||||||||||||          |||     
T  16735415 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt--agaaaaacaggg 16735512  T
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  |||||||||||||||||| |||| ||||||| ||||| ||||||| || |||||    
T  16735513 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgcc 16735593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 134 - 208
Target Start/End: Original strand, 26573200 - 26573272
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||||||||||||||||||||  |  ||||||||| ||||||||||||| |||||| |||||||||||||||    
T  26573200 taaggctgcgtacaatacaccaat--tggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcacc 26573272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 829521 - 829452
Alignment:
Q  140 tgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||| |||  ||||||||||||||| ||||||| ||||| ||||||||||||||||||    
T  829521 tgcgtacaatacaccaa-aatggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccgg 829452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 134 - 204
Target Start/End: Original strand, 33926155 - 33926224
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtg 204  Q
    |||||||| ||||||||||||| ||||  ||||||||||||| |||||||||||||||| |||||||||||    
T  33926155 taaggctgtgtacaatacacca-taatggtgggaccccttcctggaccctgcatatgcgagagctttagtg 33926224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 132 - 216
Target Start/End: Complemental strand, 25517256 - 25517174
Alignment:
Q  132 gataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||| ||||||||||||||||| ||  ||  ||||||||||||||||| ||||| ||||| |||||||||||||||||| |||||    
T  25517256 gatatggctgcgtacaatacacaaa--atggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgcc 25517174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 53996650 - 53996575
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||| ||||||||||||| |||  |||||||||||||| ||| |||| |||| |||||||||||||||||||    
T  53996650 taaggctgcttacaatacaccaa-aatggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccgg 53996575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 165 - 216
Target Start/End: Complemental strand, 10484671 - 10484620
Alignment:
Q  165 ggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||| ||||||||| |||||||||||||||||||||||| |||||    
T  10484671 ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcc 10484620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 39 - 121
Target Start/End: Complemental strand, 10870129 - 10870047
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgt 121  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||    
T  10870129 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt 10870047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 208
Target Start/End: Original strand, 25944543 - 25944615
Alignment:
Q  135 aaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||| |||||||||||||| |||  |||||||||||||| |||||||| |||| ||||||||||| |||||    
T  25944543 aaggctgagtacaatacaccaa-aatggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcacc 25944615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 172 - 216
Target Start/End: Original strand, 47624208 - 47624252
Alignment:
Q  172 ttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||| |||||||||||||||||||||||| |||||    
T  47624208 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 47624252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 89 - 157
Target Start/End: Complemental strand, 45620957 - 45620889
Alignment:
Q  89 acgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaat 157  Q
    ||||||||||||||| |||||||||||||||||        ||| ||||||||||||||||||||||||    
T  45620957 acgggttcaagttctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaat 45620889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 141 - 210
Target Start/End: Original strand, 26292410 - 26292477
Alignment:
Q  141 gcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||| |||||||||  || |||||| ||||||||| ||||||||||||||||| || |||||||||||    
T  26292410 gcgtacgatacaccaa--atgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgg 26292477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 24577935 - 24577988
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||| || ||||| |||||||||||| |||||||| |||||||||||||||||    
T  24577935 tgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgcc 24577988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 46170022 - 46169981
Alignment:
Q  165 ggaccccttcccggaccctgcatatgcgggagctttagtgca 206  Q
    |||||||||||||||||||||||||| |||||||| ||||||    
T  46170022 ggaccccttcccggaccctgcatatgtgggagcttcagtgca 46169981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 200
Target Start/End: Complemental strand, 30928203 - 30928167
Alignment:
Q  164 gggaccccttcccggaccctgcatatgcgggagcttt 200  Q
    ||||||||||||||||||||||||||| |||||||||    
T  30928203 gggaccccttcccggaccctgcatatgtgggagcttt 30928167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 45139562 - 45139488
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||| ||||||||||||| |||  |||||||||||||| || ||||| ||||||||| |||| |||||||||    
T  45139562 taaggctgcatacaatacaccaaaaatggtgggaccccttcccaga-cctgcgtatgcgggaacttt-gtgcaccgg 45139488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 216
Target Start/End: Complemental strand, 4495719 - 4495680
Alignment:
Q  177 ggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||| |||||||||||||||||||||||| |||||    
T  4495719 ggaccctgcgtatgcgggagctttagtgcaccgggttgcc 4495680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 163 - 206
Target Start/End: Original strand, 35418004 - 35418047
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgca 206  Q
    |||||||||||||||||||| ||| ||||| |||||||||||||    
T  35418004 tgggaccccttcccggaccccgcaaatgcgagagctttagtgca 35418047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 163 - 210
Target Start/End: Complemental strand, 44403612 - 44403565
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||||||| | ||||| | ||||||||||||||||    
T  44403612 tgggaccccttcccggaccctacgtatgctgaagctttagtgcaccgg 44403565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 184
Target Start/End: Original strand, 47624114 - 47624162
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctg 184  Q
    ||||||||||||||||||||||  |||  ||||||||||||||||||||||    
T  47624114 taaggctgcgtacaatacacca--aatggtgggaccccttcccggaccctg 47624162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 216
Target Start/End: Complemental strand, 54032614 - 54032575
Alignment:
Q  177 ggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||| |||||||||||||||||||||||| |||||    
T  54032614 ggaccctgcgtatgcgggagctttagtgcaccgggttgcc 54032575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 216
Target Start/End: Complemental strand, 6242331 - 6242289
Alignment:
Q  174 cccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||| |||||| ||||||||||| |||||    
T  6242331 cccggaccctgcatatgcaggagctctagtgcaccgggttgcc 6242289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 216
Target Start/End: Original strand, 31831298 - 31831339
Alignment:
Q  175 ccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||| ||| ||||||||||| |||||    
T  31831298 ccggaccctgcatatgcgggtgctctagtgcaccgggttgcc 31831339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 179 - 216
Target Start/End: Original strand, 40390357 - 40390394
Alignment:
Q  179 accctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||| |||||||||||||||||||||||| |||||    
T  40390357 accctgcgtatgcgggagctttagtgcaccgggttgcc 40390394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 217
Target Start/End: Original strand, 7943063 - 7943144
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    |||| |||||||||||||| |||  ||  ||||| ||||| || |||| ||| ||||||||||||||||||||| || ||||||    
T  7943063 taagactgcgtacaatacatcaa--atggtgggatccctttccagaccatgcgtatgcgggagctttagtgcactgggttgcct 7943144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 206
Target Start/End: Original strand, 40968621 - 40968661
Alignment:
Q  166 gaccccttcccggaccctgcatatgcgggagctttagtgca 206  Q
    ||||||||||  |||||| ||||||||||||||||||||||    
T  40968621 gaccccttcctagaccctacatatgcgggagctttagtgca 40968661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 45288111 - 45288067
Alignment:
Q  164 gggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    |||||| ||||||||||||||| |||||  |||||||||||||||    
T  45288111 gggacctcttcccggaccctgcgtatgcaagagctttagtgcacc 45288067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 55401249 - 55401324
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||| ||||||| |||||||||| |||  |||||||||||| |||||| | | ||||||||||||||  ||||||||    
T  55401249 taagactgcgtataatacaccaa-aatggtgggaccccttctcggaccttccgtatgcgggagcttttttgcaccgg 55401324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 65)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 42 - 209
Target Start/End: Complemental strand, 30395903 - 30395737
Alignment:
Q  42 taacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctg 141  Q
    |||||| |||||||| |||||| || |||||||||||    ||| | |||||||||||| || |||||||||||||||||        ||| ||||||||    
T  30395903 taaccttggcgcaactggtaaagttgttgtcatgtgactttaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agggtaaggctg 30395805  T
Q  142 cgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    |||||||||||||||||||  |||||||||||||||||||| ||||||||||||||||||||||||||    
T  30395804 cgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccg 30395737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 34725274 - 34725102
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||        ||| |||||    
T  34725274 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac---agggtaagg 34725178  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||| ||  ||  |||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  34725177 ctgcgtacaatacactaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 34725102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 20004270 - 20004094
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| || ||||| |||||| || |||||||||||    ||| | |||||||||||| || |||||||||||| ||||        ||| |||||    
T  20004270 gggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctctcgtgtaaaaaacaagg-taagg 20004172  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||  |||||||||||||| ||||| ||||||||||||||||||||||||||| |||||    
T  20004171 ctgcgtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc 20004094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 39 - 210
Target Start/End: Original strand, 14617018 - 14617186
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| ||||||||||||||| || |||||||||||   |||| | ||| |||||||| || |||||||||||||||||        ||| |||||    
T  14617018 gggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacagcctcttgtgtaaataacaagg-taagg 14617116  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
     |||||||||||||||||  ||  ||||| ||||||||||||||||||||||||||||||||||||||||||    
T  14617117 ttgcgtacaatacaccaa--atggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgg 14617186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 82 - 216
Target Start/End: Complemental strand, 35253320 - 35253191
Alignment:
Q  82 aaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggacc 181  Q
    |||||| |||||||||||| || |||||||||||||||||        ||| |||||||||||||||||||||||  ||  |||||||||||||||||||    
T  35253320 aaagatcacgggttcaagtcctcgaaacagcctcttgtgtaaaac---agggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggacc 35253226  T
Q  182 ctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||| |||||||||||||||||    
T  35253225 ctgcatatgcgggagctctagtgcaccggattgcc 35253191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 10668200 - 10668381
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatca-----aaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntagga 133  Q
    ||||||||| |||||||| |||||| || ||||||||||||       |||| | |||||||||||| || |||||||||||||||||        |||     
T  10668200 gggtaaccttggcgcaactggtaaagttgttgtcatgtgatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaagg- 10668298  T
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||| |||||||||||||||||||||  |||||||||||||||| |||||| |||||||||||||||||||||||| |||||    
T  10668299 taaggttgcgtacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgcc 10668381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 18944623 - 18944800
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | || ||||||||  || |||||||||||||||||        ||| |||||    
T  18944623 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaaggcctggaaacagcctcttgtgtaaaaaac-agggtaagg 18944721  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagc-tttagtgcaccggattgcc 216  Q
    |||||||||||||||||| |||  ||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||    
T  18944722 ctgcgtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgcc 18944800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 38478458 - 38478286
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| ||||||||  ||||| || |||||||||||   |||| | |||||||||||| ||||||||||||||||||||        ||| |||||    
T  38478458 gggtaaccttggcgcaactagtaaacttgttgtcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaac---agggtaagg 38478362  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  ||| |||||||| ||||||||||||||||||||||| ||||||||||| |||||    
T  38478361 ctgcgtacaatacaccaa--atggtggaaccccttctcggaccctgcatatgcgggagctctagtgcaccgggttgcc 38478286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 42 - 207
Target Start/End: Complemental strand, 12127010 - 12126850
Alignment:
Q  42 taacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctg 141  Q
    |||||| ||||||||  ||||| || ||||||||| ||  |||| | ||||||| ||||||| |||||||| ||||||||        ||| ||||||||    
T  12127010 taaccttggcgcaactcgtaaagttgttgtcatgtaattgaaaggtcacgggtttaagttctggaaacagcttcttgtgtaaaac---agggtaaggctg 12126914  T
Q  142 cgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    |||||||||||||||  ||  |||||||||||||||||||||||||||||||||||| ||||||||    
T  12126913 cgtacaatacaccaa--attgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcac 12126850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 39 - 208
Target Start/End: Complemental strand, 32632734 - 32632569
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || ||||||| |||   |||| | |||||||||||| || |||||||||||||||||        ||| |||||    
T  32632734 gggtaaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaac--agggtaagg 32632637  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||||||||||||||  ||  ||||||||||||||  ||||||||||||||||||||| ||||||||    
T  32632636 ctgcgtacaatacaccaa--atggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcacc 32632569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 4349712 - 4349792
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  4349712 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 4349792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 58 - 206
Target Start/End: Original strand, 27201646 - 27201793
Alignment:
Q  58 ggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaat 157  Q
    |||||| || |||||||||||   |||| | | |||||||||| || |||||||||||||||||        ||| |||||||||||||||||||||||     
T  27201646 ggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtcagaaac-agggtaaggctgcgtacaatacaccaaa 27201744  T
Q  158 aatcatgggaccccttcccggaccctgcatatgcgggagctttagtgca 206  Q
    |||  ||||||||||||||||||| ||| ||||||||||||||||||||    
T  27201745 aatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgca 27201793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 35005197 - 35005279
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||| ||||||||||||| |||  ||||||||||||||||||||||| |||||||| ||||||||||||||| |||||    
T  35005197 taaggctgcatacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgcaccgggttgcc 35005279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 42304293 - 42304211
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||| |||||||||||||| || |||  ||||||||||||||||||||||| |||| |||||||||||||||||||||||||    
T  42304293 taaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcc 42304211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 146 - 216
Target Start/End: Original strand, 50606487 - 50606557
Alignment:
Q  146 caatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||| |||  |||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  50606487 caatacaccaaaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcc 50606557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 46248131 - 46247957
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| ||| |||| |||||| || |||||||||||   |||  | ||||||||||||  | |||||||||||||||||        ||| ||||     
T  46248131 gggtaaccttggctcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaac-agggtaaga 46248033  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  ||||||||||||||||||||||| |||||||||||||||||| ||||| |||||    
T  46248032 ctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgcc 46247957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 18742043 - 18741967
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||||||||| |||  |||||||||||||| |||||||| |||||| |||||||||||||||||    
T  18742043 taaggctgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgg 18741967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 40 - 216
Target Start/End: Original strand, 19414420 - 19414591
Alignment:
Q  40 ggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggc 139  Q
    |||||||| |||| ||  |||||| || ||||||| |||   |||| | |||||||||||| ||||||| |||||||| |||        ||| ||||||    
T  19414420 ggtaaccttggcgtaattggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctagaaagagcctcttatgtaaaac---aggttaaggc 19414516  T
Q  140 tgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||  ||  ||||||||||||||| |||||||||||||||||||| ||||||||||| |||||    
T  19414517 tgcgtacaatacaccaa--atggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgcc 19414591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 39 - 215
Target Start/End: Complemental strand, 23768498 - 23768325
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||||| |||||| |||||| || |||||||||||    ||| | || |||||||||  | |||||||||||||||||        ||| |||||    
T  23768498 gggtaacctcgacgcaactggtaaagttgttgtcatgtgactgtaaggtcacaggttcaagtcatggaaacagcctcttgtgtaaaaaac-agggtaagg 23768400  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgc 215  Q
    ||||||||||||||||||  ||  |||||| ||||||| |||||||| |||||||||||||||||||| ||||||||    
T  23768399 ctgcgtacaatacaccaa--atggtgggacaccttcccagaccctgcgtatgcgggagctttagtgcagcggattgc 23768325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 57 - 200
Target Start/End: Complemental strand, 18724705 - 18724565
Alignment:
Q  57 cggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaa 156  Q
    ||||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||        ||| |||||||| ||||||||||||||    
T  18724705 cggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agggtaaggctgtgtacaatacaccaa 18724607  T
Q  157 taatcatgggaccccttcccggaccctgcatatgcgggagcttt 200  Q
      ||| ||||||||||||||||||||| ||||||||||||||||    
T  18724606 --atcttgggaccccttcccggaccctacatatgcgggagcttt 18724565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 130 - 216
Target Start/End: Complemental strand, 31382302 - 31382218
Alignment:
Q  130 aggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||||||  ||  ||||||||||||| ||||||||||||||||||||||||| || ||||| |||||    
T  31382302 aggataaggctgcgtacaatacaccaa--atggtgggaccccttcctggaccctgcatatgcgggagctttactgtaccgggttgcc 31382218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 39 - 213
Target Start/End: Original strand, 47214491 - 47214660
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||| | |||||||| |||||| || |||||||||||   |||| | |||||||||||| || ||||||| ||||||| |        ||| |||||    
T  47214491 gggtaactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtttaaaac---agggtaagg 47214587  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggatt 213  Q
     |||||||||||||||||  ||  |||||||||||||| ||||||||||||||||||||| ||||||||| ||||    
T  47214588 ttgcgtacaatacaccaa--atggtgggaccccttcccagaccctgcatatgcgggagctctagtgcaccagatt 47214660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 10378819 - 10378745
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||||||||||||  ||  ||||||||||||  ||||||||||||||||||||||||||||||||||    
T  10378819 taaggctgcgtacaatacaccaa--atggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgg 10378745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 27474381 - 27474434
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  27474381 tgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcc 27474434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 35117852 - 35117775
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcat-atgcgggagctttagtgcaccgg 210  Q
    |||||||| |||||||||||||| ||| |||||||||||||||||||||||| | |||| ||||||||||||||||||    
T  35117852 taaggctgtgtacaatacaccaaaaatgatgggaccccttcccggaccctgcgtaatgcaggagctttagtgcaccgg 35117775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 46991784 - 46991958
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| || ||||| |||||| || |||||||||||    ||| | |||||||||||| || |||||| ||||||||||        ||| |||||    
T  46991784 gggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaac-agggtaagg 46991882  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||| |||||||||||| |  ||  ||||||||||||||||||||||| |||| ||||||||||||||||||| |||||    
T  46991883 ctgtgtacaatacaccga--atggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttgcc 46991958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 139 - 216
Target Start/End: Original strand, 45402175 - 45402250
Alignment:
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  |||||||||||||| |||||||| |||||||||||||||||||||||| |||||    
T  45402175 ctgcgtacaatacaccaa--atggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgcc 45402250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 39 - 217
Target Start/End: Complemental strand, 45812713 - 45812540
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| | |||| || |||||||||||   |||| | || ||||||||| ||  |||||| |||||||||        ||| |||||    
T  45812713 gggtaaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctgaaaacagtctcttgtgtaaaag---agggtaagg 45812617  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    |||| |||||||||||||  ||  ||||||||||||||  |||||||||||||||||||| ||||||||||| ||||||    
T  45812616 ctgcatacaatacaccaa--atggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgcct 45812540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 132 - 216
Target Start/End: Complemental strand, 1517397 - 1517315
Alignment:
Q  132 gataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||||||  |  |||||||||||| | |||||||| ||||| |||||||||||||||||| |||||    
T  1517397 gataaggctgcgtacaatacaccaat--tggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgcc 1517315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 89 - 209
Target Start/End: Original strand, 6925130 - 6925247
Alignment:
Q  89 acgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcata 188  Q
    |||||||||||| || |||| ||||||||||||       |||| |||||||||| |||||||||| |  ||  |||||||||||||||| |||||| ||    
T  6925130 acgggttcaagtcctggaaatagcctcttgtgtaaaaaa-tagggtaaggctgcggacaatacaccga--atggtgggaccccttcccggtccctgcgta 6925226  T
Q  189 tgcgggagctttagtgcaccg 209  Q
    |||||||||||||||||||||    
T  6925227 tgcgggagctttagtgcaccg 6925247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 41319890 - 41319810
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  || |||||||||||||||| ||||| |||||||||||| || ||||||| || |||||    
T  41319890 taaggctgcgtacaatacaccaa--atgatgggaccccttcccgaacccttcatatgcgggagtttcagtgcactgggttgcc 41319810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 134 - 208
Target Start/End: Original strand, 19701644 - 19701717
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||| || |||||||||||||| |||  |||| |||||||||||||||||| ||||||||||||||||||||||    
T  19701644 taaggatgggtacaatacaccaa-aatggtggggccccttcccggaccctgcgtatgcgggagctttagtgcacc 19701717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 134 - 208
Target Start/End: Complemental strand, 19932839 - 19932765
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||||||||||||||||||| |||  ||||||||||||||||||||||| |||||  || | ||||||||||    
T  19932839 taaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcacc 19932765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 134 - 208
Target Start/End: Complemental strand, 45264484 - 45264411
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    |||||||| || ||||||||||| |||  |||||||||||| | |||||||||||||||||||||||||||||||    
T  45264484 taaggctgtgtgcaatacaccaa-aatggtgggaccccttctcagaccctgcatatgcgggagctttagtgcacc 45264411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 9939535 - 9939612
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggacccc-ttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||| ||||| ||||||||||| |||  ||||||||| ||| |||||||||| ||||||||||||||||||||||||    
T  9939535 taaggttgcgtgcaatacaccaaaaatggtgggacccccttctcggaccctgcgtatgcgggagctttagtgcaccgg 9939612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 23796539 - 23796613
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||| |||||||||||||||||  ||  || ||||||||||| |||||||||||||| ||||||||||||||||||    
T  23796539 taaggttgcgtacaatacaccaa--atggtgagaccccttcccagaccctgcatatgctggagctttagtgcaccgg 23796613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 89 - 211
Target Start/End: Complemental strand, 2435915 - 2435795
Alignment:
Q  89 acgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcata 188  Q
    |||||||||||| || ||||||||||| |||||       |||| |||| |||||||||||||||||| |||  ||||||||||| ||| ||||| |  |    
T  2435915 acgggttcaagtcctggaaacagcctcctgtgtgaaaaa-tagggtaagcctgcgtacaatacaccaa-aatggtgggacccctttccgtaccctccgca 2435818  T
Q  189 tgcgggagctttagtgcaccgga 211  Q
    |||||||||||||||||||||||    
T  2435817 tgcgggagctttagtgcaccgga 2435795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 4587620 - 4587568
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgc 215  Q
    ||||||||||||||||||||||| ||||||||||||| |||||||||| ||||    
T  4587620 tgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc 4587568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 135 - 210
Target Start/End: Complemental strand, 20999933 - 20999860
Alignment:
Q  135 aaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||||||||  || ||||| |||||||| | ||||||| || |||||||||||||||||||||    
T  20999933 aaggctgcgtacaatacaccaa--atgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgg 20999860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 89 - 200
Target Start/End: Original strand, 11596543 - 11596650
Alignment:
Q  89 acgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcata 188  Q
    |||||||||||| ||||||||| ||||||||||        ||| |||||||||||| ||||||||||  ||  ||||||||||||| ||||||||| ||    
T  11596543 acgggttcaagtcctagaaacaacctcttgtgtaaaaac--agggtaaggctgcgtataatacaccaa--atggtgggaccccttcctggaccctgcgta 11596638  T
Q  189 tgcgggagcttt 200  Q
    ||||||||||||    
T  11596639 tgcgggagcttt 11596650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 43768213 - 43768287
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||| ||||||||||||||  |  |||||||||||||| |||||||| ||| ||||||||||| ||||||||    
T  43768213 taaggctgcctacaatacaccaat--tggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgg 43768287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 209
Target Start/End: Original strand, 15505638 - 15505710
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    |||| ||||||||||||||||||  ||  ||||||||||||||| ||||||| |||||||||||||| ||||||||    
T  15505638 taagactgcgtacaatacaccaa--atggtgggaccccttcccgaaccctgcgtatgcgggagcttt-gtgcaccg 15505710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 135 - 207
Target Start/End: Complemental strand, 19974158 - 19974087
Alignment:
Q  135 aaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    |||| ||||||||||||||||| ||| ||||||||| ||||||||| ||   |||||||||||||||||||||    
T  19974158 aaggttgcgtacaatacaccaa-aatgatgggacccattcccggactctatgtatgcgggagctttagtgcac 19974087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 31442474 - 31442399
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||| ||||||||||||||||| |||  |||||||||||||||||| |||  |||| ||||||||| |||||||||    
T  31442474 taaggatgcgtacaatacaccaa-aatggtgggaccccttcccggacactgtgtatgtgggagctttggtgcaccgg 31442399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 163 - 207
Target Start/End: Complemental strand, 33594188 - 33594144
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    |||||||||||||| |||||||| |||||||||||||||||||||    
T  33594188 tgggaccccttcccagaccctgcgtatgcgggagctttagtgcac 33594144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 137 - 208
Target Start/End: Original strand, 7074593 - 7074663
Alignment:
Q  137 ggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    |||||||||||||||||||| |||  ||||||| ||| |  |||||||||||| ||||||||||||||||||    
T  7074593 ggctgcgtacaatacaccaa-aattgtgggacctctttctagaccctgcatatccgggagctttagtgcacc 7074663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 208
Target Start/End: Original strand, 16120819 - 16120862
Alignment:
Q  165 ggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    |||||||||||||| |||||||||||||||||||||| ||||||    
T  16120819 ggaccccttcccggcccctgcatatgcgggagctttaatgcacc 16120862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 30555216 - 30555263
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||| |||||||||| |||||| |||||||||||||||||    
T  30555216 tgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccgg 30555263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 134 - 208
Target Start/End: Original strand, 22324966 - 22325039
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||||| ||||||||||||| |||  |||  |||| ||||| ||||||| ||||||||||||||||||||||    
T  22324966 taaggctgcatacaatacaccaaaaatggtggagccccgtcccg-accctgcgtatgcgggagctttagtgcacc 22325039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 25554796 - 25554746
Alignment:
Q  166 gaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||| ||||||| ||||||||||| ||||||||||||| ||||    
T  25554796 gaccccttcccgaaccctgcgtatgcgggagcattagtgcaccggactgcc 25554746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 133 - 210
Target Start/End: Original strand, 35019303 - 35019377
Alignment:
Q  133 ataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||| ||||||||||||||  |  |||||||||| ||| |||||||| |||||| |||||||||||||||||    
T  35019303 ataaggctgcatacaatacaccaat--tggtgggacccct-cccagaccctgcgtatgcgagagctttagtgcaccgg 35019377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 200
Target Start/End: Complemental strand, 20169146 - 20169109
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagcttt 200  Q
    |||||| |||||||||||||||||||||||||||||||    
T  20169146 tgggactccttcccggaccctgcatatgcgggagcttt 20169109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 44485193 - 44485120
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||||||||||||  ||  | ||||||||||||||| ||| | |||||||||||||| |||||||||    
T  44485193 taaggctgcgtacaatacaccaa--atggttggaccccttcccggatcctacgtatgcgggagcttt-gtgcaccgg 44485120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 41 - 121
Target Start/End: Original strand, 45402077 - 45402156
Alignment:
Q  41 gtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgt 121  Q
    ||||||| |||||||| |||||| || ||||||||||||  || | | |||||||||||| || |||||||||||||||||    
T  45402077 gtaaccttggcgcaactggtaaagttgttgtcatgtgatggaagg-taacgggttcaagtcctggaaacagcctcttgtgt 45402156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 6983889 - 6983821
Alignment:
Q  140 tgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||||||  ||  ||||||||||| ||||||||||| || || |||||||| |||||||||    
T  6983889 tgcgtacaatacaccaa--atggtgggacccctttccggaccctgcgtaggcaggagctttggtgcaccgg 6983821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 15511235 - 15511158
Alignment:
Q  134 taaggctgcg--tacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||  ||||||||||||| |||  ||| ||||||||| ||||||||| |||| | |||||||||||||||||    
T  15511235 taaggctgcggatacaatacaccaa-aatggtggtaccccttcctggaccctgcgtatgtgtgagctttagtgcaccgg 15511158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 138 - 204
Target Start/End: Original strand, 6358199 - 6358264
Alignment:
Q  138 gctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtg 204  Q
    ||||||||||| ||||||| |||  |||||||||||||| |||||||| ||||| ||| ||||||||    
T  6358199 gctgcgtacaaaacaccaa-aatggtgggaccccttcccagaccctgcgtatgcaggatctttagtg 6358264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 204
Target Start/End: Complemental strand, 19386626 - 19386592
Alignment:
Q  170 ccttcccggaccctgcatatgcgggagctttagtg 204  Q
    ||||||||||||||||||||||||||||| |||||    
T  19386626 ccttcccggaccctgcatatgcgggagctctagtg 19386592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 121
Target Start/End: Complemental strand, 22930245 - 22930163
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgt 121  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | | |||||||||| || |||||||||| ||||||    
T  22930245 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagccttttgtgt 22930163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 100
Target Start/End: Original strand, 34714598 - 34714664
Alignment:
Q  34 ttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagt 100  Q
    |||| ||||||||| |||||||| |||||| || ||||||||||||  |||| | ||||||||||||    
T  34714598 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaagt 34714664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 28894611 - 28894570
Alignment:
Q  167 accccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    |||||||||  ||||||||||||||| |||||||||||||||    
T  28894611 accccttcctagaccctgcatatgcgagagctttagtgcacc 28894570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 200
Target Start/End: Original strand, 30682913 - 30682950
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagcttt 200  Q
    ||||||||||||||||||| ||| ||||||||||||||    
T  30682913 tgggaccccttcccggaccgtgcgtatgcgggagcttt 30682950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 179 - 216
Target Start/End: Original strand, 42432228 - 42432265
Alignment:
Q  179 accctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||| |||||| |||||||||||||||||    
T  42432228 accctgcatatgctggagctctagtgcaccggattgcc 42432265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 207
Target Start/End: Original strand, 50812014 - 50812085
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    ||||| ||||||||||||||||| |||  | |||||||||||||  |||||| ||||||||||||||| |||||    
T  50812014 taaggttgcgtacaatacaccaa-aatggt-ggaccccttcccgcgccctgcgtatgcgggagctttaatgcac 50812085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 39215043 - 39214968
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||||||  |||| |||  |||| |||||||||  ||||||| |||| || ||||||||||||||||    
T  39215043 taaggctgcgtacaatattccaa-aatggtgggtccccttcccaaaccctgcgtatgtggaagctttagtgcaccgg 39214968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 51)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 39461174 - 39460998
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||| ||   |||| | |||||||||||| || |||||||||||||||||        ||  |||||    
T  39461174 gggtaaccttggcgcaactggtaaagttgttgtcatgagactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agagtaagg 39461076  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||  || |||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  39461075 ctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 39460998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 39 - 210
Target Start/End: Complemental strand, 12670426 - 12670260
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||        ||| |||||    
T  12670426 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac---agggtaagg 12670330  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||||  ||  |||||||||||||||||||||||||||||||||||| |||||||||||    
T  12670329 ctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg 12670260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 39 - 210
Target Start/End: Complemental strand, 7136707 - 7136537
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||    ||| | | |||||||||| || |||||| ||||||||||        ||| |||||    
T  7136707 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaacc-agggtaagg 7136609  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||||||||  |||||||||||||||||||| |||||||||||||||||||||||||||    
T  7136608 ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgg 7136537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 13160659 - 13160832
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    |||||||||||||||||| |||||| || |||||||||||    ||| | |||||||||||| ||||||||||||||||||||        ||| |||||    
T  13160659 gggtaacctcggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaac--agggtaagg 13160756  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  ||||||||||||||||||||||| ||||||||||||| ||||| |||| |||||    
T  13160757 ctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgcc 13160832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 58 - 216
Target Start/End: Original strand, 26954108 - 26954266
Alignment:
Q  58 ggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaat 157  Q
    |||||| || |||||||||||| | ||| | |||||||||||| || |||||||||||||||||        ||| ||||||||||||||||||||||||    
T  26954108 ggtaaagttgttgtcatgtgattagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaat 26954207  T
Q  158 aatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||  |||||||||||||| ||||  |||||||||||||||||||||||| || |||||    
T  26954208 aatggtgggaccccttcccagacctcgcatatgcgggagctttagtgcactgggttgcc 26954266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 49 - 216
Target Start/End: Original strand, 6760789 - 6760955
Alignment:
Q  49 ggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaa 148  Q
    |||||||| |||||| || ||||||| |||  | ||| | |||||||||||| || |||||||||||||||||        ||| ||||||| |||||||    
T  6760789 ggcgcaactggtaaagttgttgtcatatgactagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agggtaaggcttcgtacaa 6760887  T
Q  149 tacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||  |||||||||||| ||||||| ||||||||||||||||||||||||||| |||||    
T  6760888 tacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttgcc 6760955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 40 - 210
Target Start/End: Complemental strand, 20284250 - 20284079
Alignment:
Q  40 ggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnnta-ggataagg 138  Q
    |||||||| | |||||| |||||| || |||||||||||   |||| | |||||||||||| || ||||||||||||||| |        | || |||||    
T  20284250 ggtaaccttgacgcaacgggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaagggtaagg 20284151  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||||||||  ||||||||||||||||||||||| |||||||||| |||||||||||||    
T  20284150 ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgg 20284079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 34 - 216
Target Start/End: Complemental strand, 30454278 - 30454101
Alignment:
Q  34 ttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntagga 133  Q
    |||| ||||||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||        |||     
T  30454278 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaca--agg- 30454182  T
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||| |||||||||  ||  |||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  30454181 taaggctgcgtacgatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 30454101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 2626476 - 2626653
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnnta--ggataa 136  Q
    ||||||||| |||||||  |||||| || ||||||||||| | |||| | |||||||||||| || |||||||||||||||||        |  || |||    
T  2626476 gggtaaccttggcgcaattggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaaaacagggtaa 2626575  T
Q  137 ggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    | ||||||||||||||||||  || ||||||||||||||| |||||||||||||||||||||| |||||||| |||||||    
T  2626576 gactgcgtacaatacaccaa--atgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcaccagattgcc 2626653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 40 - 210
Target Start/End: Complemental strand, 21070879 - 21070707
Alignment:
Q  40 ggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnnta--ggataag 137  Q
    |||||||| | |||||| |||||| || |||||||||||   |||| | |||||||||||| || ||||||||||||||| |        |  || ||||    
T  21070879 ggtaaccttgacgcaacgggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaaagggtaag 21070780  T
Q  138 gctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||||||||||||  ||||||||||||||||||||||| |||||||||| |||||||||||||    
T  21070779 gctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgg 21070707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 33 - 216
Target Start/End: Original strand, 17823527 - 17823707
Alignment:
Q  33 tttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntagg 132  Q
    ||||| |||||| || |||||||| |||||| || ||||||||||| | |||| | |||||||||||| || |||||||||||||||||        |||    
T  17823527 tttgaggggtaatcttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacc-agg 17823625  T
Q  133 ataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||| ||||||| ||||||||||  ||  ||| ||||||||||| ||||||||||||| |||||||||||||||||| |||||    
T  17823626 ataagactgcgtaaaatacaccaa--atggtggaaccccttcccgaaccctgcatatgcaggagctttagtgcaccgggttgcc 17823707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 20869974 - 20870056
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||||||  ||||||||||||| |||||| ||||||||||||||||||||||||||| |||||    
T  20869974 taaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttagtgcaccgggttgcc 20870056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 30 - 208
Target Start/End: Original strand, 36720744 - 36720919
Alignment:
Q  30 tagtttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnnt 129  Q
    |||||||| ||||||||| |||| ||| |||||| || |||||||||||    ||| | |||||||||||| || |||||||||||||||||            
T  36720744 tagtttgaggggtaaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac- 36720842  T
Q  130 aggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||| |||||||||||||||||||||||  ||  ||||||||||||||||||||||| ||||||| ||||||||||||||    
T  36720843 agggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacc 36720919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 45071222 - 45071395
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| ||||  || |||||| || ||||||||||||   ||| | ||||||||||||||| |||||||||||||||||        ||| |||||    
T  45071222 gggtaaccttggcgatactggtaaagttgttgtcatgtgattgtaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaac--agggtaagg 45071319  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  ||||||||||||||||||| ||| ||||||||||||| |||||||||| |||||    
T  45071320 ctgcgtacaatacaccaa--atggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgcc 45071395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 33 - 216
Target Start/End: Complemental strand, 28817810 - 28817630
Alignment:
Q  33 tttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntagg 132  Q
    ||||| ||||||||| || ||||| |||||| || |||||||||||    ||| | |||||||||||| || |||||||||||||||||        |||    
T  28817810 tttgaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agg 28817712  T
Q  133 ataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
     ||||||||||||||||||||| |  ||  ||||||||||||||||||||||| |||||||||||||||||||| ||| |||||    
T  28817711 gtaaggctgcgtacaatacaccca--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgcc 28817630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 16225070 - 16225146
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||| ||||||||||||||||||||||  ||||| |||||||||||||| |||||||||||||||||||||||||||    
T  16225070 taagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccgg 16225146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 137 - 216
Target Start/End: Original strand, 25250576 - 25250655
Alignment:
Q  137 ggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||||  ||||||||||||||| |||| ||||||||||||| ||||||||||||| |||||    
T  25250576 ggctgcgtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgcc 25250655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 39 - 210
Target Start/End: Original strand, 44530106 - 44530274
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| ||  ||||||||||  | ||| | ||||||||||||  | |||||| ||||||||||        ||| |||||    
T  44530106 gggtaaccttggcgcaactggtaaagttgctgtcatgtgactagaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaaac-agggtaagg 44530204  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||||  ||  ||||||||||||| ||||||||| ||||||||||||||||||||||||    
T  44530205 ctgcgtacaatacaccaa--atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgg 44530274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 34 - 216
Target Start/End: Complemental strand, 18164942 - 18164764
Alignment:
Q  34 ttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntagga 133  Q
    |||| |||||| || |||||||||||| || || |||||||||||   |||| | |||||||||||| || |||||||||||||||||        |||     
T  18164942 ttgaggggtaatcttggcgcaaccggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaac--aggg 18164845  T
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||| |||||||||||||||||  |  ||| ||||  |||||||||||||| |||||||||||||||||||||||| |||||    
T  18164844 taaggttgcgtacaatacaccaa--aggatgtgaccatttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 18164764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 35261636 - 35261810
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||    ||| | |||||||||||  || ||||||| |||||||||        ||| |||||    
T  35261636 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagccctggaaacagtctcttgtgtaaaaaac-agggtaagg 35261734  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
     |||||||||||||||||  ||  ||||||||||||| ||||||||| |||||||||||||||||||||||| |||||    
T  35261735 ttgcgtacaatacaccaa--atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcc 35261810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 129 - 208
Target Start/End: Complemental strand, 8897853 - 8897776
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    |||| ||||||| |||||||||||||||  ||  ||||||||||||||||||||||||||||||||||||||| ||||||    
T  8897853 tagggtaaggctacgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttactgcacc 8897776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 19729391 - 19729471
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||| ||||||||||||||  ||  ||||||||||||||||||||||||||| |||||||| |||||||| ||||||||    
T  19729391 taaggctgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatacgggagctctagtgcactggattgcc 19729471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 134 - 208
Target Start/End: Original strand, 29877145 - 29877217
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    |||||||||||||||||||||||  ||  ||||||||||||||||||||||| ||||||||||| ||||||||||    
T  29877145 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgcacc 29877217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 59 - 209
Target Start/End: Complemental strand, 24365218 - 24365071
Alignment:
Q  59 gtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaata 158  Q
    ||||| || |||||||||||  ||||  | |||||||||||  ||||||||||||||||||||        ||| |||||||||| ||||||||||||      
T  24365218 gtaaagttgttgtcatgtgactaaaatgtcacgggttcaagccctagaaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaa-- 24365121  T
Q  159 atcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    ||  ||||||||||||||||||||||| |||| ||||||||| ||||||||    
T  24365120 atggtgggaccccttcccggaccctgcgtatgtgggagcttt-gtgcaccg 24365071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 42 - 197
Target Start/End: Complemental strand, 20869671 - 20869523
Alignment:
Q  42 taacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctg 141  Q
    |||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||        ||| ||||||||    
T  20869671 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac---agggtaaggctg 20869575  T
Q  142 cgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagc 197  Q
     ||||||||||||||      || ||||||||||||||||||||||||||||||||    
T  20869574 tgtacaatacaccaa----ggtgagaccccttcccggaccctgcatatgcgggagc 20869523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 134 - 207
Target Start/End: Complemental strand, 44781590 - 44781517
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    |||||||| |||||||||||||| |||  ||||||||| |||| |||||||| |||||||||||||||||||||    
T  44781590 taaggctgtgtacaatacaccaaaaatgttgggaccccgtcccagaccctgcgtatgcgggagctttagtgcac 44781517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 39 - 215
Target Start/End: Complemental strand, 29521863 - 29521690
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| | |||| || ||||| |||||    ||| | |||||||||||| || ||||||||||||||| |        ||| |||||    
T  29521863 gggtaaccttggcgcaactgataaagttgttgtcgtgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtttaaaaaac-agggtaagg 29521765  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgc 215  Q
    ||||||||||||||||||  ||  ||||| ||| |||| |||||||| |||||||||||||||||||||||| ||||    
T  29521764 ctgcgtacaatacaccaa--atggtgggaacccatcccagaccctgcgtatgcgggagctttagtgcaccgggttgc 29521690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 12625941 - 12626021
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||| |||| |||||||||||||  ||  ||||||||| ||||||||||||| |||||||||||||||||||||||| |||||    
T  12625941 taagactgcatacaatacaccaa--atggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 12626021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 140 - 210
Target Start/End: Original strand, 16013511 - 16013581
Alignment:
Q  140 tgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||| || |||  || ||||||||||| |||||||| ||||||||||||||||||||||||    
T  16013511 tgcgtacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgg 16013581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 89 - 210
Target Start/End: Complemental strand, 5135417 - 5135300
Alignment:
Q  89 acgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcata 188  Q
    |||||||||||| || |||||||||||||||||        ||| |||||||| ||||||||||||||  ||  ||||||||||||||||||||||| ||    
T  5135417 acgggttcaagtcctggaaacagcctcttgtgtaaaaaag-agggtaaggctgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcgta 5135321  T
Q  189 tgcgggagctttagtgcaccgg 210  Q
    ||| |||||||| |||||||||    
T  5135320 tgcaggagcttt-gtgcaccgg 5135300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 207
Target Start/End: Complemental strand, 17250961 - 17250888
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    |||||| ||||||||||||||||||||  |||||||| |||||| ||||||| ||||  |||||||||||||||    
T  17250961 taaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaaggagctttagtgcac 17250888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 26102595 - 26102648
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||| |||||||||||| ||||||||||| |||||    
T  26102595 tgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgcc 26102648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 213
Target Start/End: Original strand, 389696 - 389773
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggatt 213  Q
    ||||| |||||||||||||||||  || |||||| ||||| || |||||||| |||||| ||||||||||||||||||||    
T  389696 taaggttgcgtacaatacaccaa--atgatgggatccctttcctgaccctgcgtatgcgagagctttagtgcaccggatt 389773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 135 - 210
Target Start/End: Complemental strand, 8484021 - 8483948
Alignment:
Q  135 aaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||||||||||||  |  ||||||||| |||| |||||||| |||||||||||||||| |||||||    
T  8484021 aaggctgcgtacaatacaccaat--tggtgggaccccatcccagaccctgcgtatgcgggagctttagggcaccgg 8483948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 129 - 216
Target Start/End: Original strand, 31457218 - 31457303
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||| |||||||||||||||||| |||  ||  | ||||||||||||  ||||||| |||||||||||| |||||||||||||||||    
T  31457218 taggaaaaggctgcgtacaatacatcaa--atggtaggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgcc 31457303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 10857880 - 10857960
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||| |||||||||||||  |  ||||||| ||||| ||||| ||| |||||||||||||||||||||||| |||||    
T  10857880 taaggctgcgcacaatacaccaat--tggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcaccgggttgcc 10857960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 27507988 - 27508035
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||| ||||||| ||||||||||||||||||||||||    
T  27507988 tgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgg 27508035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 134 - 215
Target Start/End: Original strand, 5689682 - 5689761
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgc 215  Q
    |||||||||||||||||||||||  ||  ||| ||||||||||| ||| ||| |||| ||||||||||||||||||| ||||    
T  5689682 taaggctgcgtacaatacaccaa--atggtggaaccccttcccgaaccatgcgtatgtgggagctttagtgcaccggtttgc 5689761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 171 - 216
Target Start/End: Complemental strand, 27468141 - 27468096
Alignment:
Q  171 cttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||| |||||||||||||||||||||||| |||||    
T  27468141 cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 27468096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 28407481 - 28407534
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||| | ||||||||||||||| |||||||| |||||    
T  28407481 tgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgcc 28407534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 44742603 - 44742528
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||||||||| |||  ||||||||||||  ||||||| |  |||||||||| ||||||||||||    
T  44742603 taaggctgcgtacaatacaccaa-aatggtgggaccccttcttggaccctacggatgcgggagcattagtgcaccgg 44742528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 216
Target Start/End: Complemental strand, 35107368 - 35107315
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||| |||  ||||||| |||||||||||||||| |||||    
T  35107368 tgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgcc 35107315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 217
Target Start/End: Original strand, 18595918 - 18595970
Alignment:
Q  165 ggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    ||||||||||||||||||||  |||||||||| ||||||||| ||| ||||||    
T  18595918 ggaccccttcccggaccctgtgtatgcgggagttttagtgcatcgggttgcct 18595970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 130 - 206
Target Start/End: Complemental strand, 30231419 - 30231344
Alignment:
Q  130 aggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgca 206  Q
    ||||||||||||||||||||| ||||| |||  |||||||| | |||| ||||| |||| | |||||||||||||||    
T  30231419 aggataaggctgcgtacaatataccaa-aatggtgggacccttacccgaaccctccatacgtgggagctttagtgca 30231344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 210
Target Start/End: Original strand, 26457775 - 26457852
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||| ||||||||||||||||||||||||  |  ||||||||||  || |||| ||| |||| |||||||||||||||||||    
T  26457775 tagggtaaggctgcgtacaatacaccaat--tggtgggacccct--cctgaccttgcgtatgagggagctttagtgcaccgg 26457852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 201
Target Start/End: Original strand, 24245527 - 24245565
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagcttta 201  Q
    ||||||||||||| ||||||||| |||||||||||||||    
T  24245527 tgggaccccttcctggaccctgcgtatgcgggagcttta 24245565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 176
Target Start/End: Original strand, 43942375 - 43942417
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttccc 176  Q
    ||||||||||||||||||||||| |||  ||||||||||||||    
T  43942375 taaggctgcgtacaatacaccaaaaatggtgggaccccttccc 43942417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 210
Target Start/End: Complemental strand, 23286380 - 23286347
Alignment:
Q  177 ggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||||||||||| |||||||||||    
T  23286380 ggaccctgcatatgcgggagctctagtgcaccgg 23286347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 216
Target Start/End: Complemental strand, 36486623 - 36486570
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||| ||||||||||| ||| ||||| ||||||||||||| |||| |||||    
T  36486623 tgggacctcttcccggaccttgcgtatgcaggagctttagtgccccgggttgcc 36486570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 164 - 209
Target Start/End: Original strand, 40444845 - 40444890
Alignment:
Q  164 gggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    |||||||||| ||||||||||| ||||  |||||||||||||||||    
T  40444845 gggaccccttgccggaccctgcgtatgttggagctttagtgcaccg 40444890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 121
Target Start/End: Original strand, 28407383 - 28407455
Alignment:
Q  49 ggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgt 121  Q
    |||||||| |||||| || |||||||||||    ||| | |||||||||||| || |||||||||||||||||    
T  28407383 ggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgt 28407455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 54)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 42805481 - 42805657
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||| ||| |||||| || |||||||||||    ||| | |||||||||||| || |||||||||||||||||        ||| |||||    
T  42805481 gggtaaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agggtaagg 42805579  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||| ||||||||||||||||||  |||||||||||||||||||| ||||||||||||||||||||||||||| |||||    
T  42805580 ctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcc 42805657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 21172185 - 21172013
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || ||||||||| |   |||| | |||||||||||| || |||||||||||||||||        ||| |||||    
T  21172185 gggtaaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac---agggtaagg 21172089  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  |||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  21172088 ctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 21172013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 33 - 216
Target Start/End: Original strand, 32758212 - 32758390
Alignment:
Q  33 tttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntagg 132  Q
    ||||| ||||||||| |||||||| |||||| || |||||||||||   |||| | || ||||||||| || |||||||||||||||||        |||    
T  32758212 tttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaac---agg 32758308  T
Q  133 ataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
     |||||||| ||||||||||||||  ||  |||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  32758309 gtaaggctgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 32758390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 89 - 216
Target Start/End: Original strand, 47716466 - 47716592
Alignment:
Q  89 acgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcata 188  Q
    |||||||||||| || |||||||||||||||||        ||| |||||||||||||||||||||||||||  |||||||||||||||||||| |||||    
T  47716466 acgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcata 47716564  T
Q  189 tgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||| ||||||||| |||||    
T  47716565 tgcgggagctttggtgcaccgggttgcc 47716592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 34 - 210
Target Start/End: Complemental strand, 2541203 - 2541029
Alignment:
Q  34 ttgatgggtaacctcggcgcaaccggtaaaattattgtcatgtga-tcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntagg 132  Q
    |||| ||||||||| |||||||| |||||| || ||||||||||| |  |||| | |||||||||||| || |||||||||||||||||        |||    
T  2541203 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agg 2541105  T
Q  133 ataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
     ||||||||||||| |||||||||  ||  |||||||||||||||| |||||| ||||||||||||||||||||||||    
T  2541104 gtaaggctgcgtactatacaccaa--atggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgg 2541029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 43 - 216
Target Start/End: Complemental strand, 10693245 - 10693077
Alignment:
Q  43 aacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgc 142  Q
    ||||| ||||||||  ||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||        ||| |||||||||    
T  10693245 aaccttggcgcaactagtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaag---agggtaaggctgc 10693149  T
Q  143 gtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||  ||  |||||||||||||||||||||||||||||||||||| |||||||| || |||||    
T  10693148 gtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcactgggttgcc 10693077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 39 - 191
Target Start/End: Original strand, 46354151 - 46354302
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || ||||||||||||   ||| | |||||||||||| || |||||| ||||||||||        ||| |||||    
T  46354151 gggtaaccttggcgcaactggtaaagttgttgtcatgtgattggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaac-agggtaagg 46354249  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgc 191  Q
    ||||||||||||||||||||||  |||||||||||||||||||| ||||||||    
T  46354250 ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc 46354302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 48735299 - 48735126
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctag-aaacagcctcttgtgtnnnnnnntaggataag 137  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| || | ||||| ||||||||||        | | ||||    
T  48735299 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtccttggaaacaacctcttgtgtaaaac---acggtaag 48735203  T
Q  138 gctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||  ||  |||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  48735202 gctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 48735126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 43557429 - 43557606
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| | |||||| |||||| || |||||||||||   |||| | | |||||||||| || |||||||||||||||||        ||  |||||    
T  43557429 gggtaaccttgccgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agagtaagg 43557527  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagc-tttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||  ||||||||| |||||||| |||| ||||||||||| ||||||||||||| |||||    
T  43557528 ctgcgtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttgcc 43557606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 68 - 216
Target Start/End: Complemental strand, 42391247 - 42391104
Alignment:
Q  68 ttgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatggga 167  Q
    |||||||||||   |||| | |||||||||||| || |||||||| ||||||||        ||| |||||||||||||||||||||||  ||  |||||    
T  42391247 ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcttcttgtgtaaaac---agggtaaggctgcgtacaatacaccaa--atggtggga 42391153  T
Q  168 ccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  42391152 ccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 42391104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 49 - 216
Target Start/End: Complemental strand, 19427057 - 19426894
Alignment:
Q  49 ggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaa 148  Q
    |||||||| |||||| || ||||||||||| | |||| | |||||||||||| || |||||||||||||||||       |||| |||| ||||||||||    
T  19427057 ggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaa-tagggtaagactgcgtacaa 19426959  T
Q  149 tacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||  ||  |||||||| ||| ||||||||||||||||| |||||| |||||||||| |||||    
T  19426958 tacaccaa--atggtgggaccc-ttctcggaccctgcatatgcgagagcttcagtgcaccgggttgcc 19426894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 42798626 - 42798800
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||    ||| | ||||||||||||  | ||||||| |||||||||        ||| |||||    
T  42798626 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttggaaacagtctcttgtgtaaaaaacaagg-taagg 42798724  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  |||||||| ||||||||||||||||||||||||||| ||||||| ||| |||||    
T  42798725 ctgcgtacaatacaccaa--atggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgcc 42798800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 44 - 216
Target Start/End: Original strand, 27629596 - 27629765
Alignment:
Q  44 acctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcg 143  Q
    |||| |||||||| |||||| || ||||||| ||| | |||| | |||||||||||| || |||||||||||||||||        ||| ||||| ||||    
T  27629596 accttggcgcaactggtaaagttgttgtcatttgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac-agggtaaggttgcg 27629694  T
Q  144 tacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    || ||||||||||  ||  |||||||||||||||| |||||||||||||| ||||| |||||||||| |||||    
T  27629695 taaaatacaccaa--atggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttgcc 27629765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 134 - 216
Target Start/End: Original strand, 7879689 - 7879769
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  ||||||||||||||||||||||| ||||||||||||| |||||||||| |||||    
T  7879689 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggttgcc 7879769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 89 - 216
Target Start/End: Original strand, 29907426 - 29907549
Alignment:
Q  89 acgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcata 188  Q
    |||||||||||| ||||||||||||||||||||       |||  ||||||||||| ||||||||||| |||  ||||||||| ||||||||||||  ||    
T  29907426 acgggttcaagtcctagaaacagcctcttgtgtaaaaaa-tagtgtaaggctgcgttcaatacaccaa-aatggtgggaccccatcccggaccctg--ta 29907521  T
Q  189 tgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||| |||||    
T  29907522 tgcgggagctttagtgcaccgggttgcc 29907549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 43 - 216
Target Start/End: Complemental strand, 11617762 - 11617592
Alignment:
Q  43 aacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgc 142  Q
    |||||||||||||| |||||| || |||||||||||   |||| | || ||||||||| || |||||| ||||||||||        ||| |||| ||||    
T  11617762 aacctcggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaac-agggtaagactgc 11617664  T
Q  143 gtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||  ||  ||||||||||||| ||||||||| ||||| ||| |||||||||||||| |||||    
T  11617663 gtacaatacaccaa--atggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgcc 11617592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 39 - 217
Target Start/End: Complemental strand, 47078031 - 47077858
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | |||||||||||| || ||||||| |||||||||       |||  ||| |    
T  47078031 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaa---tagagtaaag 47077935  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
     |||||||||||||| ||  ||  ||||||||||||||  ||||| |||||||||||||| ||||||||||||||||||    
T  47077934 ttgcgtacaatacacaaa--atggtgggaccccttcccaaaccctacatatgcgggagctctagtgcaccggattgcct 47077858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 42 - 209
Target Start/End: Original strand, 40463837 - 40464000
Alignment:
Q  42 taacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctg 141  Q
    |||||| ||||||||||||||| || |||||||||||    ||| | ||||||||||||  ||||||||| |||||||||         || ||||||||    
T  40463837 taaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatagaaacagtctcttgtgtaaaaact--gggtaaggctg 40463934  T
Q  142 cgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    |||| ||||||||||  ||  |||||||||||| |||||||||| ||||||||||||| |||||||||    
T  40463935 cgtataatacaccaa--atggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccg 40464000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 139 - 210
Target Start/End: Original strand, 21566491 - 21566561
Alignment:
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||||||| |||  | ||||||||||||| ||||||||||||||||||||||||||||||||    
T  21566491 ctgcgtacaatacaccaa-aatggtaggaccccttcccgaaccctgcatatgcgggagctttagtgcaccgg 21566561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 135 - 216
Target Start/End: Complemental strand, 27889399 - 27889320
Alignment:
Q  135 aaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||||||  ||  ||||||||||||||||||||||| |||||||||||||| || |||||| |||||    
T  27889399 aaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgcc 27889320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 144 - 216
Target Start/End: Complemental strand, 38262270 - 38262200
Alignment:
Q  144 tacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||  || |||||||||||||||| || |||| ||||||||||||||||||||||||||||||    
T  38262270 tacaatacaccaa--atgatgggaccccttcccgaacactgcgtatgcgggagctttagtgcaccggattgcc 38262200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 135 - 208
Target Start/End: Original strand, 39123945 - 39124018
Alignment:
Q  135 aaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||||||| |||||||||| |||  ||||||||||||||||||||||| |||| ||||||||| |||||||    
T  39123945 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc 39124018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 89 - 210
Target Start/End: Original strand, 16341285 - 16341404
Alignment:
Q  89 acgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcata 188  Q
    |||||||||||||||||||||||||||||||||        ||| ||||||| ||||||||||||||| |||  |||| || |||||||||||   ||||    
T  16341285 acgggttcaagttctagaaacagcctcttgtgtaaaaaac-agggtaaggctacgtacaatacaccaa-aatggtgggccctcttcccggacctatcata 16341382  T
Q  189 tgcgggagctttagtgcaccgg 210  Q
    |||||||||||| |||||||||    
T  16341383 tgcgggagctttggtgcaccgg 16341404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 129 - 216
Target Start/End: Complemental strand, 18512542 - 18512457
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||| ||||||||||||||||||||| |  ||  ||||||||||||||||||||||| |||||||||||||| |||||| || |||||    
T  18512542 tagggtaaggctgcgtacaatacaccga--atggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcactgggttgcc 18512457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 130 - 217
Target Start/End: Complemental strand, 33871998 - 33871913
Alignment:
Q  130 aggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    |||||||||||||||||||||||||||  ||  |||||||||||||| |||||||  |||||| ||||||||||||||| | ||||||    
T  33871998 aggataaggctgcgtacaatacaccaa--atggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcaccaggttgcct 33871913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 39 - 210
Target Start/End: Complemental strand, 22699148 - 22698977
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| | |||||| |||||| || |||||||||||   |||| ||| |||||||||| || |||| || |||||||||        ||| ||||     
T  22699148 gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggttatgggttcaagtcctggaaatagtctcttgtgtaaaaaac-agggtaaga 22699050  T
Q  139 ctgcgtacaatacaccaataatcatgggacccctt-cccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||||||||| |||  |||||||| || |||||||||||  |||||||||||| |||||||||||    
T  22699049 ctgcgtacaatacaccaaaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccgg 22698977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 31591193 - 31591113
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||  ||  ||  ||||||||||||||||||| |||||||||||||||| ||||||||||| |||||    
T  31591193 taaggctgcgtacaatacaataa--atggtgggaccccttcccggaccttgcatatgcgggagctctagtgcaccgggttgcc 31591113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 18747538 - 18747612
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||||||||||| |||||||||||  |  ||||||||||||| | ||||||| ||||||||||||||||||||||||    
T  18747538 taaggctgcgtataatacaccaat--tggtgggaccccttcctgaaccctgcgtatgcgggagctttagtgcaccgg 18747612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 19265865 - 19265938
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||||||||  |||  ||||||||||||||||| ||| |||||| |||||||||||||||||||    
T  19265865 taaggctgcgtacaatacacca--aatggtgggaccccttcccgga-cctacatatgtgggagctttagtgcaccgg 19265938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 34626385 - 34626212
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    |||||||||  ||||||| |||||| || ||||||||||||  ||||   || | ||||||| || ||||||||||| |||||        ||| |||||    
T  34626385 gggtaaccttagcgcaactggtaaagttgttgtcatgtgattgaaaggccacagattcaagtcctggaaacagcctcctgtgtaaaaac--agggtaagg 34626288  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||| |||||||||||  ||  ||||| ||||||||||||||||| ||||||||||||||||| || ||| |||||    
T  34626287 ctgcgttcaatacaccaa--atggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttgcc 34626212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 39 - 208
Target Start/End: Original strand, 42476830 - 42476994
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||| | |||| ||| |||||| || |||||||||||  ||||| | |||| |||||||||| ||||||| |||||||||        ||| |||||    
T  42476830 gggtaacattggcgtaactggtaaagttgttgtcatgtgactaaaaggtcacggattcaagttctggaaacagtctcttgtgtaaaaca--agg-taagg 42476926  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||||||||||||||  ||  |||||||||||||  | | ||||||||||||||||| |||||||||    
T  42476927 ctgcgtacaatacaccaa--atggtgggaccccttcctaggctctgcatatgcgggagctctagtgcacc 42476994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 129 - 216
Target Start/End: Original strand, 11741839 - 11741924
Alignment:
Q  129 taggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||| |||||||||||||||||||||||  ||  ||||| |||||||||||  ||||| ||||||||||| ||||||||||| |||||    
T  11741839 tagggtaaggctgcgtacaatacaccaa--atggtgggatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgcc 11741924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 209
Target Start/End: Original strand, 23231608 - 23231681
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    |||||||||||| |||||||| |  || |||||||||||||||| ||||||| ||||||| |||||||||||||||    
T  23231608 taaggctgcgtataatacaccga--atgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccg 23231681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 135 - 208
Target Start/End: Complemental strand, 45019010 - 45018935
Alignment:
Q  135 aaggctgcgtacaatacaccaataatca--tgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    |||||||||||||||| ||||| || |   ||| ||||||||||||||||||| ||||||||||||||||||||||    
T  45019010 aaggctgcgtacaatataccaaaaaactggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcacc 45018935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 163 - 210
Target Start/End: Complemental strand, 35334873 - 35334826
Alignment:
Q  163 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    ||||||||||||||||||||||| ||||| ||||||||||||||||||    
T  35334873 tgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgg 35334826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 134 - 199
Target Start/End: Original strand, 19266501 - 19266564
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctt 199  Q
    |||||||||||||||||||||||  ||  ||||| ||||||||||||||||| |||||||||||||    
T  19266501 taaggctgcgtacaatacaccaa--attgtgggatcccttcccggaccctgcgtatgcgggagctt 19266564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 92 - 210
Target Start/End: Complemental strand, 28362270 - 28362156
Alignment:
Q  92 ggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgc 191  Q
    ||||||||| |||||||| |||||||||||       | || |||||||||||||||||||||||  ||  |||||||||||||| |||| ||||||||     
T  28362270 ggttcaagtcctagaaactgcctcttgtgtaaaaaacttgg-taaggctgcgtacaatacaccaa--atggtgggaccccttcccagaccttgcatatgt 28362174  T
Q  192 gggagctttagtgcaccgg 210  Q
    ||||||||| |||||||||    
T  28362173 gggagcttt-gtgcaccgg 28362156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 134 - 210
Target Start/End: Original strand, 38604577 - 38604652
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagcttt-agtgcaccgg 210  Q
    |||||||||||||||||||||||  ||  || |||||||| ||||||||||| |||||||||||||| ||||||||||    
T  38604577 taaggctgcgtacaatacaccaa--atggtgagacccctttccggaccctgcgtatgcgggagctttaagtgcaccgg 38604652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 217
Target Start/End: Original strand, 1408508 - 1408589
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    |||||||| |||||||||| |||  ||  ||||||||||||||||||||||| ||||| | | ||||||| |||||||||||||    
T  1408508 taaggctgtgtacaatacagcaa--atggtgggaccccttcccggaccctgcgtatgcagaatctttagttcaccggattgcct 1408589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 214
Target Start/End: Complemental strand, 14732906 - 14732827
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattg 214  Q
    ||||||||||| ||||||||||| |||  ||  || |||||||| ||||||  ||||||||||||||||||||||||||||    
T  14732906 taaggctgcgt-caatacaccaaaaatggtgaaactccttcccgaaccctgtttatgcgggagctttagtgcaccggattg 14732827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 130 - 216
Target Start/End: Complemental strand, 23066013 - 23065929
Alignment:
Q  130 aggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||| | ||||||||||||||||   || |||||| ||||| ||| | |||||||||| ||||||||| |||||||||||||||    
T  23066013 aggataaagttgcgtacaatacaccat--atgatgggatccctttccgaatcctgcatatgtgggagctttggtgcaccggattgcc 23065929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 134 - 205
Target Start/End: Original strand, 33500564 - 33500635
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgc 205  Q
    |||| |||||||| |||||| || |||  ||||||||||||||||||||||| ||||||||| ||| |||||    
T  33500564 taagactgcgtactatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcgggatcttcagtgc 33500635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 35787353 - 35787273
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||| |||||||||||||||||  ||   |||||||||||||||||| ||| ||||||||||||| | |||||||| |||||    
T  35787353 taaggttgcgtacaatacaccaa--atggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgggttgcc 35787273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 208
Target Start/End: Complemental strand, 42495913 - 42495874
Alignment:
Q  169 cccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||||||||||||| ||||||||||||||||||||||    
T  42495913 cccttcccggaccctgcgtatgcgggagctttagtgcacc 42495874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 205
Target Start/End: Complemental strand, 3469255 - 3469190
Alignment:
Q  140 tgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgc 205  Q
    ||||||||||||||||| |||   ||||||||||||  |||||||  |||||||||||||||||||    
T  3469255 tgcgtacaatacaccaaaaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgc 3469190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 69 - 206
Target Start/End: Complemental strand, 23419822 - 23419688
Alignment:
Q  69 tgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaatacaccaataatcatgggac 168  Q
    ||||||||||  ||||| | || |||||||||||| |||||||||||||||||        ||| |||| |||||||||||||||||  |||  ||||||    
T  23419822 tgtcatgtgactaaaaggtcacaggttcaagttctggaaacagcctcttgtgtaaaaaac-agggtaagactgcgtacaatacacca--aatggtgggac 23419726  T
Q  169 cccttcccggaccctgcatatgcgggagctttagtgca 206  Q
    |||||||  |||| ||| | |||||| |||||||||||    
T  23419725 cccttcctagaccttgcgtgtgcgggggctttagtgca 23419688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 210
Target Start/End: Complemental strand, 39093524 - 39093449
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg 210  Q
    |||| ||| ||||||||||||| ||||  ||||| ||||||||||| | ||||||||| | ||||||||||||||||    
T  39093524 taagactgtgtacaatacacca-taatagtgggaacccttcccggaacttgcatatgcagaagctttagtgcaccgg 39093449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 39 - 119
Target Start/End: Complemental strand, 42496013 - 42495933
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgt 119  Q
    ||||||||| |||||||| |||||| || ||||||| |||   |||| | |||||||||||| || |||||||||||||||    
T  42496013 gggtaaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt 42495933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 121
Target Start/End: Complemental strand, 44123769 - 44123717
Alignment:
Q  69 tgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgt 121  Q
    ||||||||||   ||||||||||||||||||| || |||||||||||||||||    
T  44123769 tgtcatgtgactgaaagattacgggttcaagtactggaaacagcctcttgtgt 44123717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 200
Target Start/End: Original strand, 13805152 - 13805216
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagcttt 200  Q
    |||||||| ||||||||||||||  ||  ||||||| ||||| ||||||||| ||||||||||||||    
T  13805152 taaggctgtgtacaatacaccaa--atggtgggaccacttcctggaccctgcgtatgcgggagcttt 13805216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 216
Target Start/End: Original strand, 36602535 - 36602578
Alignment:
Q  173 tcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||| |||||||| |||||||||||||||||||||||| |||||    
T  36602535 tcccagaccctgcgtatgcgggagctttagtgcaccgggttgcc 36602578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 121
Target Start/End: Complemental strand, 5180335 - 5180253
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgt 121  Q
    ||||||||| | |||||| |||||| || |||||||||||   |||| | | |||||||| |||| |||||||||||||||||    
T  5180335 gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcaagggttcaacttctggaaacagcctcttgtgt 5180253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 121
Target Start/End: Original strand, 18326991 - 18327073
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgt 121  Q
    ||||||||| |||||||| |||||| || |||||||||||    ||| | |||||||||||| |  |||||||||||||||||    
T  18326991 gggtaaccttggcgcaactggtaaagttgttgtcatgtgacttgaaggtcacgggttcaagtcccggaaacagcctcttgtgt 18327073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 209
Target Start/End: Original strand, 25434112 - 25434144
Alignment:
Q  177 ggaccctgcatatgcgggagctttagtgcaccg 209  Q
    ||||||||| |||||||||||||||||||||||    
T  25434112 ggaccctgcgtatgcgggagctttagtgcaccg 25434144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 30536 - 30708
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| |||||||| |||||| || |||||||||||   |||| | || ||||||||| || |||||||||||||||||        ||| || ||    
T  30536 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgtgtaaaac---agggtaggg 30632  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  |||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  30633 ctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 30708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0180 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0180
Description:

Target: scaffold0180; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 24217 - 24137
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  |||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  24217 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgcc 24137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 59; Significance: 4e-25; HSPs: 4)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 49 - 216
Target Start/End: Original strand, 46798 - 46962
Alignment:
Q  49 ggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggctgcgtacaa 148  Q
    |||||||  |||||| || |||||||||||  | ||| | |||||||||||| || |||||| ||||||||||       |||| ||||| |||||||||    
T  46798 ggcgcaattggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtgctggaaacaacctcttgtgtaaaaaa-tagggtaaggttgcgtacaa 46896  T
Q  149 tacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||  ||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||    
T  46897 tacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 46962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 206
Target Start/End: Complemental strand, 24856 - 24786
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgca 206  Q
    ||||||||||||||| |||||||  ||  ||||||||||||||| ||||||| ||||||||||||||||||||    
T  24856 taaggctgcgtacaacacaccaa--atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgca 24786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 134 - 207
Target Start/End: Original strand, 43708 - 43780
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcc-cggaccctgcatatgcgggagctttagtgcac 207  Q
    |||||||||||||||||||||||  ||  ||||||||||| | ||||||||||||||||||||||| ||||||||    
T  43708 taaggctgcgtacaatacaccaa--atggtgggacccctttctcggaccctgcatatgcgggagctctagtgcac 43780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 206
Target Start/End: Complemental strand, 46792 - 46721
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgca 206  Q
    ||||| ||| ||||||| ||||| |||  |||||||||||||| |||||||| ||||||||||||||| ||||    
T  46792 taaggatgcatacaatataccaa-aatggtgggaccccttcccagaccctgcgtatgcgggagctttaatgca 46721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: scaffold0049
Description:

Target: scaffold0049; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 41 - 216
Target Start/End: Original strand, 58936 - 59110
Alignment:
Q  41 gtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataaggct 140  Q
    ||||||| || ||||| |||||| ||||||||||||||   |||| | |||||||||||| || ||||||||||||||| |        ||| |||| ||    
T  58936 gtaaccttggagcaactggtaaacttattgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaac-agggtaagact 59034  T
Q  141 gcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||| |||  |||||||||||||| ||| |||| |||||||||||||||||||| ||| |||||    
T  59035 gcgtacaatacaccaaaaatggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttgcc 59110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 134 - 216
Target Start/End: Complemental strand, 48718 - 48638
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||||||||||  ||  |||||||||||||||||||||||||||||||||||| ||||||||||| |||||    
T  48718 taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 48638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0258 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: scaffold0258
Description:

Target: scaffold0258; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 13201 - 13028
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| ||||||||||||||| || |||||||||||   |||| | || ||||||||| || |||||||||||||| ||        ||| |||||    
T  13201 gggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgcgtaaaaaca-agg-taagg 13104  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    |||||||||||||||| |  ||  |||||||||||||| |||||||| |||||||| ||||||||||||||| |||||    
T  13103 ctgcgtacaatacaccga--atggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgcc 13028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: scaffold0187
Description:

Target: scaffold0187; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 10226 - 10054
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| | |||||| |||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||        ||  ||||     
T  10226 gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac---agagtaaga 10130  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  ||||||||||||||||||||||||||||| ||||||  |||||||||| |||||    
T  10129 ctgcgtacaatacaccaa--atagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgcc 10054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 39 - 216
Target Start/End: Complemental strand, 20554 - 20382
Alignment:
Q  39 gggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgtnnnnnnntaggataagg 138  Q
    ||||||||| | |||||| |||||| || |||||||||||   |||| | |||||||||||| || |||||||||||||||||        ||  ||||     
T  20554 gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac---agagtaaga 20458  T
Q  139 ctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcc 216  Q
    ||||||||||||||||||  ||  ||||||||||||||||||||||||||||| ||||||  |||||||||| |||||    
T  20457 ctgcgtacaatacaccaa--atagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgcc 20382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1176 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold1176
Description:

Target: scaffold1176; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 130 - 217
Target Start/End: Complemental strand, 1675 - 1590
Alignment:
Q  130 aggataaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggattgcct 217  Q
    ||||||||||||| |||||||||||||  || ||||||||||||||||||||| || |||||||||||||||||||||| | ||||||    
T  1675 aggataaggctgcatacaatacaccaa--atgatgggaccccttcccggacccggcgtatgcgggagctttagtgcaccaggttgcct 1590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0311 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0311
Description:

Target: scaffold0311; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 137 - 207
Target Start/End: Original strand, 10864 - 10932
Alignment:
Q  137 ggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcac 207  Q
    |||||||| |||||||||||  ||  ||||||||||||||||||||||| |||||||||||||||||||||    
T  10864 ggctgcgtccaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac 10932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 134 - 208
Target Start/End: Original strand, 11180 - 11252
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||||| |||||||||||||  ||  |||||| ||||||||||||||||||||||||||||| |||||||||    
T  11180 taaggctgcttacaatacaccaa--atggtgggacaccttcccggaccctgcatatgcgggagctctagtgcacc 11252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0954 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0954
Description:

Target: scaffold0954; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 209
Target Start/End: Original strand, 3595 - 3668
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg 209  Q
    |||||||||||| |||||||| |  || |||||||||||||||| ||||||| ||||||| |||||||||||||||    
T  3595 taaggctgcgtataatacaccga--atgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccg 3668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 50 - 121
Target Start/End: Original strand, 43097 - 43168
Alignment:
Q  50 gcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgtgt 121  Q
    ||||||| |||||| |||||||||||||||  |||| | ||| ||||| || ||||||||||||||||||||    
T  43097 gcgcaactggtaaagttattgtcatgtgattgaaaggtcacgagttcaggtcctagaaacagcctcttgtgt 43168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 134 - 208
Target Start/End: Complemental strand, 72951 - 72879
Alignment:
Q  134 taaggctgcgtacaatacaccaataatcatgggaccccttcccggaccctgcatatgcgggagctttagtgcacc 208  Q
    ||||||||| |||||||||||||  ||  | | ||||||||||||| ||||| ||||||||||||||||||||||    
T  72951 taaggctgcctacaatacaccaa--atggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcacc 72879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 40 - 119
Target Start/End: Complemental strand, 226583 - 226504
Alignment:
Q  40 ggtaacctcggcgcaaccggtaaaattattgtcatgtgatcaaaagattacgggttcaagttctagaaacagcctcttgt 119  Q
    |||||||| |||||||| |||||| || |||||||||||   |||| | |||| ||||||| ||||||||||||||||||    
T  226583 ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgt 226504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0254 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0254
Description:

Target: scaffold0254; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 130 - 183
Target Start/End: Original strand, 4204 - 4258
Alignment:
Q  130 aggataaggctgcgtacaatacaccaataa-tcatgggaccccttcccggaccct 183  Q
    ||||||||| |||||||||||||||||||| |  |||||||||||||||||||||    
T  4204 aggataaggttgcgtacaatacaccaataattggtgggaccccttcccggaccct 4258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University