View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3720_high_5 (Length: 264)
Name: NF3720_high_5
Description: NF3720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3720_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 108 - 248
Target Start/End: Complemental strand, 37479506 - 37479366
Alignment:
| Q |
108 |
cttttcatccttaagttgtttaaactagttaaacaacacgaactccgcgataaccaacaatggattagcttagttgctgtgatgcatattttagttggcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |||||||| || |
|
|
| T |
37479506 |
cttttcatccttaagttgtttaaactagttaaacaacacgaactccgcgataaccaacaatggattggcttagttgttgtgatgcataatttagttgacc |
37479407 |
T |
 |
| Q |
208 |
tgaaaaagaatttcatcaggagagatgaaagagatgcaatt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37479406 |
tgaaaaagaatttcatcaggagagatgaaagagatgcaatt |
37479366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 13 - 65
Target Start/End: Complemental strand, 37479570 - 37479518
Alignment:
| Q |
13 |
aaaataataaccaacaatgatttcttttaatggaatttttagagtttgaacta |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37479570 |
aaaataataaccaacaatgatttcttttaatggaatttttagaatttgaacta |
37479518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University