View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3724_low_3 (Length: 314)
Name: NF3724_low_3
Description: NF3724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3724_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 294
Target Start/End: Complemental strand, 22383748 - 22383474
Alignment:
| Q |
12 |
acaattcatatcataaactaaacaaaccaatttcaaccacccaaatcatatcaatggcaaggattgcaactgcaggggattcagttccctgatggaccca |
111 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22383748 |
acaattgatatcataaactacacaaaccaatttcaaccacccaaatcatatcaatggtcaggattgcaactgcagcggattcagttccctgatggaccca |
22383649 |
T |
 |
| Q |
112 |
tttttgattgaacatgacttggaaggttcatgctttcaatttca-ttaaaagaaacaa--tacacatttcaacaaagagaataataatcacttccaagaa |
208 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
22383648 |
tttttgattgaa-----------aggttcatgctttcaatttcaattaaaagaaacaaaatacacatttcaacaaagagaataataatcagttccaataa |
22383560 |
T |
 |
| Q |
209 |
tatgcgacacgaaagagtttcaaatagtacactagcatcacttcactaaaattaaagcacaaagtaaaataactgaaaaccgaata |
294 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22383559 |
tatgggacacgaaagagtttcaaatagtacactagcatcacttcactaaaattaaagcacaaagtaaaataactgaaaaccgaata |
22383474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University