View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3724_low_9 (Length: 223)
Name: NF3724_low_9
Description: NF3724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3724_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 207
Target Start/End: Complemental strand, 24632260 - 24632068
Alignment:
| Q |
15 |
ttatactcatttattttttgcaggaactttaattatgggaaacctctaattttatcctcaaatagttccagcacctatcttttcaaattttattctcatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24632260 |
ttatactcatttattttttgcaggaactttaattatgggaaacctctaattttatcctcaaatagttccagcacctatcttttcaaattttattctcatg |
24632161 |
T |
|
| Q |
115 |
ttctaatccatttaaatcaaaaccctgatgaacaagttctagctgacaacaattagcaggactaaaagggacatgagatactagtttttgaac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24632160 |
ttctaatccatttaaatcaaaaccctgatgaacaagttctagctgacaacaattagcaggactaaaagggacatgagatactagtttttgaac |
24632068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 60
Target Start/End: Complemental strand, 24685599 - 24685554
Alignment:
| Q |
15 |
ttatactcatttattttttgcaggaactttaattatgggaaacctc |
60 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24685599 |
ttatagtcatttattttttgcaggaactttaattatgggaaccctc |
24685554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University