View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3725_low_10 (Length: 308)
Name: NF3725_low_10
Description: NF3725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3725_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 18 - 298
Target Start/End: Original strand, 41244813 - 41245093
Alignment:
| Q |
18 |
ggaatttggaaccctaacttttttgctacgaattcggtgtgaaatggaagcttttaagtagtgataattgtaattgttgtgagttgaataatcgtttaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41244813 |
ggaatttggaaccctaacttttttgctacgaattcggtgtgaaatggaagcttttaagtggtgataattctaattgttgtgagttgaataatcgtttaca |
41244912 |
T |
|
| Q |
118 |
cgtttatatagcgtttaggatctttatcgaaaatttgtgtttatgacagcgtagcgatccgtgcgtgatcttgcaatggagaagattgtaaacgttggat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41244913 |
cgtttatatagcgtttaggatctttatcgaaaatttgtgtttatgacagcgtagcgatccgtgcgtgatcttgcaatggaaaagattgtaaacgttggat |
41245012 |
T |
|
| Q |
218 |
ttgatgttatcgacggatgaggattgtttgcttggcgatccgtgtgttttgaaatggaccaatgaatgcgctgatcctatg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41245013 |
ttgatgttatcgacggatgaggattgtttgcttggcgatccgtgtgttttgaaatggaccaatgaatgcgctgattctatg |
41245093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University