View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3725_low_16 (Length: 245)

Name: NF3725_low_16
Description: NF3725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3725_low_16
NF3725_low_16
[»] chr1 (1 HSPs)
chr1 (54-245)||(7299045-7299236)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 54 - 245
Target Start/End: Complemental strand, 7299236 - 7299045
Alignment:
54 tagagactacaaccaaatgagcaaaatctgtgtattcttttgagtctccaaaaggaattattattgcttaggaaaaatgatgcttttgctagttggttta 153  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7299236 tagagactgcaaccaaatgagcaaaatctgtgtattcttttgagtctccaaaaggaattattattgcttaggaaaaatgatgcttttgctagttggttta 7299137  T
154 ttatggtatgaaaagttgggaccattttggtttaaagtcattttctatgtagccaatttacttggctttgaagaaagtgcataacttctatc 245  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7299136 ttatggtatgaaaagttgggaccattttggtttaaagtcattttctatgtagccaatttacttggctttgaagaaagtgcataacttctatc 7299045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University