View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_high_101 (Length: 260)
Name: NF3726_high_101
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_high_101 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 6 - 247
Target Start/End: Complemental strand, 46072886 - 46072645
Alignment:
| Q |
6 |
agcagcacagaaccaaatgtcgctttcaagataccaccaaaactacctagatctaaaccagaatatgctgcctctgctcccaaggcagagtgtaactttg |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46072886 |
agcagcaatgaaccaaatgtcgctttcaagataccaccaaaattacctagatctaaaccagaatatgctgcctctgctcccaaggcagagtgtaactttg |
46072787 |
T |
|
| Q |
106 |
tggacccagactcacctgtgaaaataccaaggactgtacgaaaggcatcatcatcgaatggtggcgtgccattttgggacaggaacgctgcaggtaagtc |
205 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46072786 |
tggaccctgactcacctgtgaaaataccaaggactgtacgaaaggcaccatcattgaatggtggcgtgccattttgggacaggaacgctgctggtaagtc |
46072687 |
T |
|
| Q |
206 |
tgatgaatctgtcagtaaggagcctgaagtgtgtgaagatag |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46072686 |
tgatgaatctgtcagtaaggagcctgaagtgtgtgaagatag |
46072645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University