View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_high_105 (Length: 254)
Name: NF3726_high_105
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_high_105 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 36161479 - 36161717
Alignment:
| Q |
1 |
caccaaagagtcctgttctttctcgtgtgccatcaagtccattggagaatactgaattaggaccattgtgtttgtgtccaagaggaagatggtagttaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36161479 |
caccaaagagtcctgttctttctcgtgtgccatcaagtccattggagaatactgaattagcaccattgtgtttgtgtccaagaggaagatggtaattaat |
36161578 |
T |
 |
| Q |
101 |
taannnnnnnaatacttgctagtttgaatagtttttatatctgatttcaaaagtttaaccttagacttactgtggcnnnnnnnnaattgatttaatttca |
200 |
Q |
| |
|
||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36161579 |
taatttttttaatacttgctagtttgaataatttttatatctgatttcaaaagtttaaccttagacttactgtggcttttttttaattgatttaatttca |
36161678 |
T |
 |
| Q |
201 |
ggtatgcaatttgctgtttctttattctggtttgccttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36161679 |
ggtatgcaatttgctgtttctttattctggtttgccttg |
36161717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University