View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_high_107 (Length: 253)
Name: NF3726_high_107
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_high_107 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 49705311 - 49705564
Alignment:
| Q |
1 |
ttgtcagcgtgttcccgggaattcttcaacgtcgttttctgtattcgcggtatctttcactatttcaatttcagattatatatttactccttttgaacta |
100 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
49705311 |
ttgtcagcgcgttcccgggaactcttcaacgtcgttttctgtattcgcggtatatttcactatttcagtttcagattatttatttactccttttgaacta |
49705410 |
T |
 |
| Q |
101 |
catgacataatagcttagctagctgtccggagattgctttaa-ttttttac-tcacttcttctggttcacagatctttgatggacacaatggaaatgctg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49705411 |
catgacataatagcttagctagctgtccggagattgctttaatttttttacttcacttcttctggttcacagatctttgatggacacaatggaaatgctg |
49705510 |
T |
 |
| Q |
199 |
ctgctgtttatactaaggaaaatttgctaaatcatgtgctctgtgctcctcctc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||| ||||| |
|
|
| T |
49705511 |
ctgctgtttatactaaggaaaatttgctaaatcatgtgttgtgtgctcttcctc |
49705564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 174 - 235
Target Start/End: Complemental strand, 6009326 - 6009265
Alignment:
| Q |
174 |
tttgatggacacaatggaaatgctgctgctgtttatactaaggaaaatttgctaaatcatgt |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||| ||||||| ||| | |||||| |||| |
|
|
| T |
6009326 |
tttgatggacacaatggatctgctgctgctatttattctaaggagaatcttctaaataatgt |
6009265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University