View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_high_111 (Length: 251)
Name: NF3726_high_111
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_high_111 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 8 - 251
Target Start/End: Original strand, 38480039 - 38480282
Alignment:
| Q |
8 |
aagcaaaggcagtgtgaatggtgtattcaggtagcttcagaaaatatactgagtaattcccttgctcttgctttattgaacagaaacttgattgattgct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38480039 |
aagcaaaggcagtgtgaatggtgtattcaggtagcttcagaaaatatactgagtaattcccttgctcttgctttattgaacagaaacttgattgattgct |
38480138 |
T |
 |
| Q |
108 |
gtggatgcaggactgtgctcatagcgaacaatgtatctcttctcaacaaagaggctaatgctccaatctacagccctgaagaccttaaaaatataaaaaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38480139 |
gtggatgcaggactgtgctcatagcgaacaatgtatctcttctcaacaaagaggctaatgctccaatctacagccctgaagaccttaaaaacataaaaaa |
38480238 |
T |
 |
| Q |
208 |
gatagctgaaagagatgatacatttgatcttcttggtaattcac |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38480239 |
gatagctgaaagagatgatacatttgatcttcttggtaattcac |
38480282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University