View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_high_128 (Length: 241)
Name: NF3726_high_128
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_high_128 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 139 - 229
Target Start/End: Complemental strand, 27972045 - 27971955
Alignment:
| Q |
139 |
acatcgctcgtctaaatttcctgtcatacacttaagtttaggatgtactaaaatcacttggattggtctagtggtgttggccagggacctt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27972045 |
acatcgctcgtctaaatttcctgtcatacacttaagtttaggatgtactaaaatcacttggattggtctggtggtgttggccagggacctt |
27971955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 82
Target Start/End: Complemental strand, 27972178 - 27972115
Alignment:
| Q |
19 |
actatttcatgtctaaattaatcaattttgtattgaatttttatttgtttggaccctattcctc |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27972178 |
actatttcatgtctaaattaatcaattttgtattgaatttttatttgcttggaccctattcctc |
27972115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University