View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_high_129 (Length: 241)
Name: NF3726_high_129
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_high_129 |
 | |
|
| [»] scaffold0037 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0037 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: scaffold0037
Description:
Target: scaffold0037; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 97 - 226
Target Start/End: Original strand, 33728 - 33857
Alignment:
| Q |
97 |
ctcatgcttttttctctctttttgtccaaaccaaataatgcaaaatcattcctcccctcttccacaccactagtccgccacaacacccataaatacacac |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33728 |
ctcatgcttttttctctctttttgtccaaaccaaataatgcaaaatcattcctcccctcttccacaccactagtccgccacaacacccataaatacacac |
33827 |
T |
|
| Q |
197 |
atctaaacaccaataattagtaaggtttct |
226 |
Q |
| |
|
||| |||||||||||||||||||||||||| |
|
|
| T |
33828 |
atcaaaacaccaataattagtaaggtttct |
33857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0037; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 33632 - 33675
Alignment:
| Q |
1 |
ttagctgagtcagacacatgtgtgtcattttttatttctaaaat |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33632 |
ttagctgagtcagacacatgtgtgtcattttttatttctaaaat |
33675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 104 - 224
Target Start/End: Original strand, 10427673 - 10427792
Alignment:
| Q |
104 |
ttttttctctctttttgtccaaaccaaataatgcaaaatcattcctcccctcttccacaccactagtccgccacaacacccataaatacacacatctaaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10427673 |
ttttttctctctttttgtccaaaccaaataatgcaaaattattcctcccctcg-ccacaccactagtccgccacaacacccataaatacacacatcaaaa |
10427771 |
T |
|
| Q |
204 |
caccaataattagtaaggttt |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10427772 |
caccaataattagtaaggttt |
10427792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 44
Target Start/End: Original strand, 10427572 - 10427612
Alignment:
| Q |
4 |
gctgagtcagacacatgtgtgtcattttttatttctaaaat |
44 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
10427572 |
gctgagtcggacacatgtgtgtaattttttatttctaaaat |
10427612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University