View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_high_136 (Length: 232)
Name: NF3726_high_136
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_high_136 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 4 - 214
Target Start/End: Original strand, 2048673 - 2048883
Alignment:
| Q |
4 |
ggaggagcagagagggaactcttgtccaagcaagtgaacaagtaattggagctgacatgtgagaaagcatagactgaagcacattctgcaaaccaaatat |
103 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2048673 |
ggaggaacagagggggaactcttgtccaagcaagtgaacaaataattggagctgacatgtgagaaagcatagactgaagcacattctgcaaaccaaatat |
2048772 |
T |
 |
| Q |
104 |
atctaaagttattgctccattaaaggtcttgcgcccttggaggtctaaactctaagggtgcgcttgccttgctaaacaatatgtattagacaaaataaca |
203 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2048773 |
atctaaagttactgctccattaaaggtcttgcgcccttggaggtctaaactctaagggtgcatttgtcttgctaaacaatatgtattagacaaaataaca |
2048872 |
T |
 |
| Q |
204 |
caagacaaaac |
214 |
Q |
| |
|
||||||||||| |
|
|
| T |
2048873 |
caagacaaaac |
2048883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University