View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_high_146 (Length: 214)
Name: NF3726_high_146
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_high_146 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 21 - 191
Target Start/End: Original strand, 12332986 - 12333160
Alignment:
| Q |
21 |
gtggatcaaaattatcgaacagggaagaacagatgttatttataaaaaataaaagaggaacaagaaacaaacctgagaagaagaaaggaaccctagaacg |
120 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12332986 |
gtggatcaaaattattgaacagggaagaacagatgttatttataaaaaataaaagaggaacaagaaacaaacctgagaagaagaaaggaaccctagaacg |
12333085 |
T |
|
| Q |
121 |
gggaataaggaaggaaggacggcgg--acggtggtgatgatggcg--acttcagggatggtgatgaatggaaatc |
191 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12333086 |
gggaataaggaaggaaggacggcggctacggtggtgacgatggcgacacttcagggatggtgatgaatggaaatc |
12333160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University