View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_high_23 (Length: 433)
Name: NF3726_high_23
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_high_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 413; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 413; E-Value: 0
Query Start/End: Original strand, 1 - 417
Target Start/End: Complemental strand, 41705598 - 41705182
Alignment:
| Q |
1 |
gaacatatacatctagtatcaattggtcccatagatctttatatttttatggtattccatattgtagattcttggagccactttattccatttcagtagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705598 |
gaacatatacatctagtatcaattggtcccatagatctttatatttttatggtattccatattgtagattcttggagccactttattccatttcagtagc |
41705499 |
T |
|
| Q |
101 |
tatgcatagcctttttatttctttgattgcattcatatcaatgcataacagttttcttctcttaattatccatgcaaaatgattattgaatcaactagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705498 |
tatgcatagcctttttatttctttgattgcattcatatcaatgcataacagttttcttctcttaattatccatgcaaaatgattattgaatcaactagga |
41705399 |
T |
|
| Q |
201 |
gacattgttttcattttagctatgccttttttctttgccttttcctctgtcactatacttgttcacaaaagacttgtccaaactgtggttctatgaaagt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705398 |
gacattgttttcattttagctatgccttttttctttgccttttcctctgtcactatacttgttcacaaaagacttgtccaaactgtggttctatgaaagt |
41705299 |
T |
|
| Q |
301 |
tccatatcctttgagcacagaaccaaactgtggcgatccattctatagacttcgttgcgatcctcattctcaaaagctttactttgacactctcaatggc |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705298 |
tccatatcctttgagcacagaaccaaactgtggcgatccattctatagacttcgttgtgatcctcattctcaaaagctttactttgacactctcaatggc |
41705199 |
T |
|
| Q |
401 |
agttcctatgttgtact |
417 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41705198 |
agttcctatgttgtact |
41705182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 208 - 275
Target Start/End: Complemental strand, 1441132 - 1441065
Alignment:
| Q |
208 |
ttttcattttagctatgccttttttctttgccttttcctctgtcactatacttgttcacaaaagactt |
275 |
Q |
| |
|
|||| ||||||||||||||||| |||| || |||||||| ||||| ||| |||||||||||||||||| |
|
|
| T |
1441132 |
tttttattttagctatgcctttcttctgtgtcttttcctttgtcattattcttgttcacaaaagactt |
1441065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 303 - 341
Target Start/End: Complemental strand, 1441050 - 1441012
Alignment:
| Q |
303 |
catatcctttgagcacagaaccaaactgtggcgatccat |
341 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1441050 |
catatcctttgagcacagaaccaaattgtggcgatccat |
1441012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University