View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_high_65 (Length: 319)
Name: NF3726_high_65
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_high_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 59 - 248
Target Start/End: Complemental strand, 35311427 - 35311238
Alignment:
| Q |
59 |
ccatgtgaattttatcatatcaaataagtgtattgaaaaatatgcattaaaatgagtgttgctggtatttatcaatgtatgtagtacatgttttggttat |
158 |
Q |
| |
|
|||||||| ||||||||||||| |||||| ||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35311427 |
ccatgtgacttttatcatatcagataagtatattgaaaaatatgcattaaaatgaatgttgctagtatttatcaatgtatgcggtacatgttttggttat |
35311328 |
T |
 |
| Q |
159 |
acatgaatcatttacttgtgaattatggatgaaaataggtatggtcgtataatatatgttttcgtactagcagtataaaaacataatata |
248 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35311327 |
acatgcatcatttacttgtgaattatggatgaaaatagatatggtcgtataatatatgttttcgtactagcagtataaaaacataatata |
35311238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 190 - 319
Target Start/End: Complemental strand, 35311238 - 35311109
Alignment:
| Q |
190 |
aaaataggtatggtcgtataatatatgttttcgtactagcagtataaaaacataatatatttgtctaattattatatgaaagacatagacaaacattcct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35311238 |
aaaataggtatggtcgtataatatatgttttcgtactagcagtataaaaacataatatatttgtctaattattatatgaaagacatagacaaacattcct |
35311139 |
T |
 |
| Q |
290 |
tatgcactcaacccatgatgagtgaattca |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35311138 |
tatgcactcaacccatgatgagtgaattca |
35311109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University