View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3726_high_76 (Length: 301)
Name: NF3726_high_76
Description: NF3726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3726_high_76 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 36161485 - 36161358
Alignment:
| Q |
1 |
tttggtgcaacttgaggatcttcaacttttatatgaatagcctcctcagattcagctcttgtagtaccatcaacccctttctctgaaacatgttttgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36161485 |
tttggtgcaacttgaggatcttcaacttttatatgaatagcctcctcagattcagctcttgtagcaccatcaacccctttctctgaaacatgttttgatt |
36161386 |
T |
|
| Q |
101 |
gatttattacattatttgtatatgaatg |
128 |
Q |
| |
|
|||| ||||||||||||||||||||||| |
|
|
| T |
36161385 |
gattaattacattatttgtatatgaatg |
36161358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 184 - 295
Target Start/End: Complemental strand, 36161302 - 36161191
Alignment:
| Q |
184 |
atgtacaaggagttgattttgtgactgtaatgctttaaatcagtaccatacctttgttattggcctcaaacaaaggcttatgattatgattcatttttcc |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36161302 |
atgtacaaggagttgattttgtgactgtaatgctttaaatcagtaccatacctttgttattggcctcaaacaaaggcttatgattatgattcatttttcc |
36161203 |
T |
|
| Q |
284 |
tgcctttgcttc |
295 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
36161202 |
tgccttggcttc |
36161191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University